Skip to main content

Advertisement

Table 2 Oligonucleotides used in this study

From: The tyrosyl-tRNA synthetase like gene located in the tyramine biosynthesis cluster of Enterococcus duransis transcriptionally regulated by tyrosine concentration and extracellular pH

Primer Function* Sequence (5' to 3')
TDC11 RT1 tyrS probe amplification (F) tyrS probe amplification (R) TCAATTACAGATCGGTGGGG ACTTACCATCGAATGCATCAAATG
TRNA2B(2) TRNA(P) TyrS prom (F) tyrS prom (R) mRNA-C quantification (F) mRNA-C quantification (R) mRNA-L quantification (F) mRNA-L quantification (R) CGTAAATTAGAAGGGCCAGAGGCAG GATCAAGCCAGATTGCGCCACCTGCAG AACAGGCAATGATCAAAACGAAGTA CATAGGCTCCTAAAATGTAATTCGC
TYR2 PtyrS mapping (R) ACTTCGTTTTGATCATTGCCTG
TDC123 TDC130 PtyrSΔ cloning and sequencing (F) PtyrSΔ cloning and sequencing (R) AAAACTTCCCATATGCATTGTAACG CTGCAGCATTTTATATGTTTTGTAGTAA
TYS (F) TYS(R) tyrS overexpression (F) tyrS overexpression (R) ATGGGTGGTGGATTTGCTAATATTATCGATGAATTAACTT TTGGAAGTATAAATTTTCATCAACTACTTTGGCCAAAAAG
  1. *F, forward; R, reverse