Skip to main content

Table 2 Oligonucleotides used in this study

From: The tyrosyl-tRNA synthetase like gene located in the tyramine biosynthesis cluster of Enterococcus duransis transcriptionally regulated by tyrosine concentration and extracellular pH

Primer Function* Sequence (5' to 3')
TDC11
RT1
tyrS probe amplification (F)
tyrS probe amplification (R)
TCAATTACAGATCGGTGGGG
ACTTACCATCGAATGCATCAAATG
TRNA2B(2)
TRNA(P)
TyrS prom (F)
tyrS prom (R)
mRNA-C quantification (F)
mRNA-C quantification (R)
mRNA-L quantification (F)
mRNA-L quantification (R)
CGTAAATTAGAAGGGCCAGAGGCAG
GATCAAGCCAGATTGCGCCACCTGCAG
AACAGGCAATGATCAAAACGAAGTA
CATAGGCTCCTAAAATGTAATTCGC
TYR2 PtyrS mapping (R) ACTTCGTTTTGATCATTGCCTG
TDC123
TDC130
PtyrSΔ cloning and sequencing (F)
PtyrSΔ cloning and sequencing (R)
AAAACTTCCCATATGCATTGTAACG
CTGCAGCATTTTATATGTTTTGTAGTAA
TYS (F)
TYS(R)
tyrS overexpression (F)
tyrS overexpression (R)
ATGGGTGGTGGATTTGCTAATATTATCGATGAATTAACTT
TTGGAAGTATAAATTTTCATCAACTACTTTGGCCAAAAAG
  1. *F, forward; R, reverse