Skip to main content

Table 2 Primer sequences

From: Expression of Shigella flexneri gluQ-rs gene is linked to dksAand controlled by a transcriptional terminator

Name Sequence 5- 3a Reference and characteristics
opeF TAAGGAGAAGCAACATGCAAGA This work. RT-PCR of dksA operon from nucleotide +40 to +1477b
dksAF ATGCAAGAAGGGCAAAACCG This work. RT-PCR of dksA gene from nucleotide +54 to +488
interF AGTGGAAGACGAAGATTTCG This work, RT-PCR of intergenic region from nucleotide +368 to +863
gQRSF TTCAAAGAGATGACAGACACACAG This work, RT-PCR of gluQ-rs gene from nucleotide +567 to +1074
rrsHF CCTACGGGAGGCAGCAG [40] RT-PCR of ribosomal RNA 16S
pcnBR GATGGAGCCGAAAATGTTGT Reverse of pcnB gene from nucleotide +1993
PdksAF GGATCCAAGCGAAGTAAAATACGG BamHI site, from nucleotide −506
PgluQF GGATCCAAGAAGGGCAAAACCGTA BamHI site, from nucleotide +58
TERMGQ3 ATAAGGCGGGAGCATAACGGAGGAGTGGTAAAC Recognition from nucleotide +560, underline sequence are nucleotides changed
ATGGQRSF GGATCCGTAATTACAGCCGTTCCATC BamHI site, from nucleotide +507. Underline nucleotides correspond to the stop codon of dksA
  1. aNucleotides in bold are indicated restriction site.
  2. bFragments cloned are indicated based on the transcription start of dksA identified by [25].