Skip to main content

Table 2 Primers used in this study

From: A connecter-like factor, CacA, links RssB/RpoS and the CpxR/CpxA two-component system in Salmonella

Primers Sequence (5’ → 3’)
Primers for strain and plasmid constructions
35 GTTGAAATTATTGAGTAGTAGCAACTCACGTTACCAGTAACATATGAATATCCTCCTTAG
36 GACAGGGATGGTGTCTATGGAAAGGAAAACAGGGTTGTTAGTGTAGGCTGGAGCTGCTTC
37 CCCGGCGCAAGAAGGTAAAATGCCTGCTGCGGCAGAATAACATATGAATATCCTCCTTAG
38 TGTCGACAAGACCGGCGGTCTTAAATTATGCGGAAAGTTAGTGTAGGATGGAGCTGCTTC
84 ACATAATCAGGACTCACTGCAGCTTGCGGACGCGCAATAACATATGAATATCCTCCTTAG
85 AATGTCGGCGCTTCTGTTCCCCAGGAAGGCTAATCGTTTAGTGTAGGCTGGAGCTGCTTC
333 TCCTACACTATCGTGTAAAGTAGTTAACATTGAGGATGTACATATGAATATCCTCCTTAG
336 GTTAGCGCGGATACAATAGCGGTATCAGCGACCAGGGTTAGTGTAGGCTGGAGCTGCTTC
337 GGAATTCTAACATTGAGGATGTAATGT
338 ACGCGTCGACTTAAAAATCGCTATATTGCT
367 ACCATGCCACTATTGATTAAAGCCAGTCAGGGGAGAGAACGTGTAGGCTGGAGCTGCTTC
368 GGCCGGTAAAGCAATTTCCGCTCACTCTTCCGTTTGGTCACATATGAATATCCTCCTTAG
393 ATTGCGTGGTCGCGGCTATCTGATGGTTTCCGCTTCATGAGTGTAGGCTGGAGCTGCTTC
394 GATAAAAAATCGGCCTGCATTCGCAGGCCGATGGTTTTTACATATGAATATCCTCCTTAG
451 ACATAATCAGGACTCACTGCAGCTTGCGGACGCGCAATAACTCTAATGCGCTGTTAATCACT
452 GTTGTAAAACGACGGCCAGTGAATCCGTAATCATGGTCATCTAAGCACTTGTCTCCTGTT
453 ACATAATCAGGACTCACTGCAGCTTGCGGACGCGCAATAATTCTCAACGGGGAACATTCC
454 GTTGTAAAACGACGGCCAGTGAATCCGTAATCATGGTCATTACATCCTCAATGTTAACTA
473 TTGCTAGTTCCGTCAAGGGATCACGGGTAGGAGCCACCTTGTGTAGGCTGGAGCTGCTTC
474 GCCAGTCGACAGACTGGCCTTTTTTTGACAAGGGTACTTACATATGAATATCCTCCTTAG
639 GAGGAATAATAAATGTTCGCGCTGGTACTTTTTG
640 TTAAAAATCGCTATATTGCTGCGCAGG
832 ACATAATCAGGACTCACTGCAGCTTGCGGACGCGCAATAACTCAAAAAGAACCCGTCGCC
833 GCAGGGGGGAAATGAGAAAAGGAAGAATAAATAACCCGCCTG
834 CTTTTCTCATTTCCCCCCTGCGCTAACCTCTCGTACACTATCGTGTAAAGTAGTTAACATTGAGGATGTA
835 CTTTTCTCATTTCCCCCCTGCGCTAACCTCACGTACACTATCGTGTAAAGTAGTTAACATTGAGGATGTA
836 CTTTTCTCATTTCCCCCCTGCGCTAACCTCTCCTTCACAATCGTGTAAAGTAGTTAACATTGAGGATGTA
1160 GCTACACCAACACGCCAGGCTTATTCCTGTGGAGTTATATGTGTAGGCTGGAGCTGCTTC
1161 CCATACAGCGCCTTTGTCATTCGACGTATAAAAGGTATTACATATGAATATCCTCCTTAG
1164 ACAATTCTGCTCATTGTCTGCCAACAACTATGGGGATCTCGTGTAGGCTGGAGCTGCTTC
1165 AGTCGCCTTTTTTACTTTTGTTACTGATTTGTAAAAACTACATATGAATATCCTCCTTAG
1166 CGCGTAGCGGGACGTCTTCCGACGTATTCAGAGGTTAGCTGTGTAGGCTGGAGCTGCTTC
1167 GAGGTGAAAACGGGGCACAAGATGCGCCCCGTGGCGTTTACATATGAATATCCTCCTTAG