Skip to main content

Advertisement

Table 1 Primers used for Real-Time PCR

From: Changes in human gut flora with age: an Indian familial study

Target organism Primer Sequence PCR product (bp)
Clostridium coccoides-Eubacteria rectale group ClEubF CGGTACCTGACTAAGAAGC 429 [47]
  ClEubR AGTTTYATTCTTGCGAACG  
Prevotella PrevF CACCAAGGCGACGATCA 283 [19]
  PrevR GGATAACGCCYGGACCT  
Lactobacillus group LacF AGCAGTAGGGAATCTTCC 341 [48]
  LacR ACACCGCTACACATGGAG  
Bacteroides-Prevotella group BacF GAAGGTCCCCCACATTG 410 [49]
  BacR CAATCGGAGTTCTTCGTG  
Bifidobacterium BifF GCGTGCTTAACACATGCAAGTC 126 [50]
  BifR CACCCGTTTCCAGGAGCTATT  
Roseburia RosF TACTGCATTGGAAACTGTCG 230 [19]
  RosR CGGCACCGAAGAGCAAT  
All bacteria 27F TCCTACGGGAGGCAGCAGT 316 [This study]
  343R GACTACCAGGGTATCTAATCCTGTT  
  1. Legend: ClEub- Clostridium coccoides-Eubacteria rectale group specific primers, Prev- Prevotella genus specific primers, Lac- Lactobacillus genus specific primers, Bac-Prev- Bacteriodes-Prevotella specific primers, Bif- Bifidobacterium genus specific primers , Ros- Roseburia genus specific primers and All bacteria- universal primers for all bacteria.