Skip to main content

Advertisement

Table 4 Primer sequences

From: Differential infection properties of three inducible prophages from an epidemic strain of Pseudomonas aeruginosa

Primer Sequence (5′-3′) Amplicon (bp) Cycling conditions Reference
Multiplex PCR:
LES1nestF tttggtgatgatcggcttagc 289 95°C, 4 min then 30 cycles: 95°C, 30 s; 58°C, 30 s; 72°C, 30 s; final extension step, 72°C, 7 min; [25]
LES1nestR tgtggaagcgatcagtct    
Clust6nestF ggatcgacgtggcataatctg 410   [25]
Clust6nestR acgattctccggcatgcagcg    
4tot1F gctcatgagtggctgacaac 105   This study
4tot1R tcttgggcagagaaccattc    
Q-PCR:
2pro3F caagccctgtctggattttc 102 95°C, 10 min; then 40 cycles: 95°C, 10 s; 60°C, 15 s; 72°C s. This study
2pro3R gagacaggttgggagggagt    
3tot1F cgcaggtaccaccagacttt 122   This study
3tot1R catgtccagcaggttcaaaa    
3pro3F gcggatgttctcaaacgaat 134   This study
3pro3R cgggagaagcaatgacctac    
4tot1F gctcatgagtggctgacaac 105   This study
4tot1R tcttgggcagagaaccattc    
4pro3F tcgtgctgtgctgatctttt 172   This study
4pro3R agcagtgccagttgatgttg    
Preparation of DIG-labeled probes:
φ2intDIGF tgcctatctaacggggttca 1097 95°C, 4 min. 30 cycles: 95°C, 30 s; 55°C, 30 s; 72°C, 1 min s; final extension step, 72°C, 7 min This study
φ2intDIGR gaagcaaccgagaagtggag   
φ3intDIGF ggatcatgtagcgggaaaga 874 This study
φ3intDIGR agaacctggcgaaagtctga   
φ4cIDIGF atcgttaattggcacggaat 893 This study
φ4cIDIGR acagcaacggatttccactc   
  1. tot = to quantify total phage copies; pro = to quantify total phage copies.