Skip to main content

Advertisement

Table 1 Primers used in this study for construction of plasmids encoding colonisation promoting K. pneumoniae C3091 genes

From: Novel screening assay for in vivo selection of Klebsiella pneumoniae genes promoting gastrointestinal colonisation

Primer Sequence (5’ → 3’)a
recA-Bsp HI GCGCGCTCATGA CGGAGCGGCGTGATGAAGG
recA-Hind III GCGCGCAAGCTT AAATATTAACGGCGAAGCGAACAC
arcA-Bsp HI GCGCGCTCATGA TCGCGTGGACTGGTATGC
arcA-Hind III GCGCGCAAGCTT TGAGCCGGGTAAAGATTGTGACTA
kpn_01507-Bsp HI GCGCGCTCATGA GCAATGACCGCCGGGACAGGAG
kpn_01508-Hind III GCGCGCAAGCTT TCTAGGATCGCCGGCACAATAATG
  1. a Restriction sites highlighted by underscoring.