Skip to main content

Advertisement

Table 3 Oligos used in this work

From: Tigecycline challenge triggers sRNA production in Salmonella enterica serovar Typhimurium

Name Sequence 5’-3’ Ref
For deletion of sY20 in SL1344
sYJ20_Cm_F CTTGATTGCTGCCCGGCAACAAAA TCACTACACTAACGCCGTGTAGGC TGGAGCTGCTTC This work
sYJ20_Cm_R CTTTGCACCTCAGTTAAAGAGTGG CAAAGGACTTGAGATGGGAATTAG CCATGGTCC  
For cloning sYJ20 coding sequence onto pACYC177
sYJ20_HF CCCAAGCTTCTTGATTGCTGCCCGG CAACAA This work
sYJ20_BR CGGGATCCCTTGAGAGGTAGCCTC AAATCCCTT  
For the northern blot assays
NsYJ5 AGGTTTTACTGCTCGTTTTTCA This work
NsYJ20 ATCCGGATCAGGTTCGACGGGTAT  
NsYJ75 GCGGGGATTTCTTCCCTTGC  
NsYJ118 TGTGTTTCAATTTTCAGCTTGATCCAGATT  
5S CTACGGCGTTTCACTTCTGAGTTC [53]
For qPCR
16SF GTTACCCGCAGAAGAAGCAC This work
16SR CTACGCATTTCACCGCTACA  
tbpAF GGCTGGAAAAACGACACATT  
tbpAR TAGACTTTGCGCATCCACAG  
ycfR-F TGCCGTACTGAGTTCGCTCT  
ycfR-R GGGCCGGTAACAGAGGTAAT  
dinF-F TTACTGGGGCTGGTCGATAC  
dinF-R GCCAGCAATAACGGTTGAAT  
q5S-F CATGCCGAACTCAGAAGTGA  
q5S-R AGTTCCCTACTCTCGCATGG  
For 5’RACE
GSP1 GGCGAAATAGCCGTAAT This work
GSP2 GGGCACCTTGACCGCTTCAT  
GSP3 GCCACGCCGCTTTTGGCAAA