Skip to main content

Table 4 Oligonucleotide sequences used in this study

From: Physiology of deletion mutants in the anaerobic β-myrcene degradation pathway in Castellaniella defragrans

Primer Sequence (5`→ 3`) Amplicon (bp) Target gene
ldi deletion construct    
 (pK19mobsacB    
 ORF25_Eco RI_F TCGTAGAATTC CATGCCTGCGCACGCTGATG 1307 ORF25
 ORF25_Xho I_ATG_R GAGACTCGAG ATGTTCAGTCGCATGTCGTCT   
 ORF27_Xho I_TAA_F TATACTCGAG TAAGGGGGACGCGGCGGCCTG 763 ORF27
 ORF27_Hind III_R TCGTAAAGCTT ATGGACGACGGCACATGGA   
 p27 + _F ACGAAGCCGAGCATGCCCAC 2199 encompassing
 p27 + _R AGCAGCAGGCCGACGTGTTC   ORF27
 p27mismatch_F CGCCCGGTTCGAGGAAGG - nucleotide
 p27mismatch_R CCCTTCCTCGAACCGGGCG   exchange
geoA deletion construct    
 (pK19mobsacB)    
 ORF2930_Xba I_F TCTAGA CCACCAGGGCGCATGCTTCAGTT 1749 ORF2930
 ORF2930_Xho I_R CTCGAG TGAGCAGGGCGCGACTCC   
 ORF32_Xho I_F CTCGAG CATCGTTGAGTGTCTCCTGGTTG 1712 ORF32
 ORF32_Hind III_R AAGCTT TGGAAACGACATAGGGGACAGGA   
Control of ldi or geoA deletion    
 ldi _F CGCCACCACCGAGGACTATTTC 432 ldi
 ldi _R AGGTGGGCATGCTCGGCTTCGTA   
 ORF25_401_F GAAGGTGCGCGGCAAGGAATA 2463a/ ORF25-27
 ORF27_2005_R CATGGACAGCGGCACACGGGCAA 1269b  
 geoA _260_F ACCGGGTCGTGCTGTCCTTCAAT 284 geoA
 geoA _527_R CGCGCCGGTCTGGATGC   
 ORF30_30967_F CCAGACGCCGCCGATGATGAAGAG 1904a/ ORF30-32
 ORF32_32822_R TATCTGAACAAGCCCGAACTGACC 740c  
ldi complementation construct    
 (pBBR1MCS-4)    
 ldi _Eco RI_F TGCGGAATTC ATGCGGTTCACATTG 1206 ldi
 ldi _Bgl II_R CGCGAGATCT TTATTTCCCTGCGA   
geoA complementation construct    
 (pBBR1MCS-2)    
 geoA _Xba I_F AATCTAGA CGCCCTGCTCAGAACAC 1290 geoA
 geoA _Hind III_R GAGCAAGCTT ACCCTGCGCAAGCAGTTC   
Control of adjacent gene transcription    
 ORF25_254_F CCCACCGGCTTCTCGTAGTC 535 ORF25
 ORF25_788_R GCAAGGGCCTGGGCGTGATGTC   
 ORF27_28_F CATGGACAGCGGCACACGGGCAA 350 ORF27
 ORF27_377_R CAGTGGACCTCGCCGTGGAAAT   
 ORF30_315_F CGCGGGCGGGATGGTGAT 411 ORF30
 ORF30_725_R CGGGCGGCGGGTTCGTT   
 ORF32_608_F CCTGGCGGCCGGACGACAT 462 ORF32
 ORF32_1069_R CGCCGGAAGGGGAAACGAC   
  1. Restriction sites are underlined. Oligonucleotide primers derived from annotated 50 kb contig of C. defragrans 65Phen (Acc. no. FR669447.2)[47]. a wild type; b C. defragrans Δldi, c C. defragransΔgeoA.