Skip to main content

Advertisement

Table 4 Oligonucleotide primers used in qRT-PCR with B. fragilis and B. thetaiotaomicron

From: The effect of environmental conditions on expression of Bacteroides fragilis and Bacteroides thetaiotaomicron C10 protease genes

Primer Sequence
qBfp1_F TTTAACAAGAAGCGGTGAACAAAGAA
qBfp1_R TGCAATAGGAATACAACCCGCATAAT
qBfp2_F CTACAAAGATAAAGCCACGGGAGCTA
qBfp2_R TCTGTCTCCTCCCATAAAAACAGGTC
qBfp3_F GAGGTTGTAAAAACGACACCAGCAAT
qBfp3_R TGAGTATGCATAAATAGGTGCGGTTC
qBfp4_F TCGTAGTGGGCAGTCAGGTTACTACA
qBfp4_R ACTCTCCCAAACCATAGAATCCCAAT
q16S_Bf_F GCGCACGGGTGAGTAACACGTAT
q16S_Bf_R CGTTTACTGTGTGGACTACCAGG
qBtpA_F CGTCTTCTACCCCTTGTTTGAGATGT
qBtpA_R TTAAGTGACACGCTTCAATATCAGGAA
qBtpC_F GTGCTGTTATTTCAATAGCACAGATT
qBtpC_R TCTAGTTGTTTCAGAGGAAGGAGTTT
qBtpB_F TGGTATAAAAATAGATTGGGAAGCAT
qBtpB_R GGATGAGTACCAGAAAGGTCATAAAT
qBtpZ_F AATTGTGGTAATATTCAAAAATGGAG
qBtpZ_R AATATGCATTACTGCTAGAAGATTCG
q16S_Bt_F TCACTGGACTGCAACTGACACTGAT
q16S_Bt_R ACTCCCCAGGTGGAATACTTAATGCT