Skip to main content

Advertisement

Table 3 Oligonucleotide primers used in the Reverse Transcriptase PCR study on B. thetaiotaomicron RNA

From: The effect of environmental conditions on expression of Bacteroides fragilis and Bacteroides thetaiotaomicron C10 protease genes

Primer Sequence
BtpA_F CAGCAGGGATCCGATGACACAGAAGTAATGAAAC
BtpA_R CAGCAGGAATTCTTATTTTATTATGTTAATATATGG
BtpB_F CAGCAGGGATCCAATGATGAAGAAGGTTTGGATTTAC
BtpB_R CAGCAGGAATTCCTTTTACAATATAATATCACAGATC
BtpC_F CAGCAGGGATCCCTAGGTATGCAAGATAATCTG
BtpC_R CAGCAGGAATTCTTATTTATTTATAATATTGTAAATC
BtpZ_F CAGCAGGGATCCAAATATAATAGATGCAGAACGG
BtpZ_R CAGCAGGAATTCTTATCTTTTTCTTATATCAGGTATAA
BtiA_R CAGCAGGAATTCTTATTCTTTGGCCTTTTGTATTATAG
BtiB_F CAGCAGGGATCCGAAGATGATGAAATATATATCAATG
BtiB_R CAGCAGGAATTCTTATGGATTTTGCTTTATTGTATATG
BtiZ_F CAGCAGCATATGAATTCTCCAAATTGTAATATAAAAA
BtiZ_R CAGCAGGAATTCTTAAAGTTCAAAATCCCCCGATAAATC