Skip to main content

Table 2 List of primers and their related properties used in this study

From: Molecular characterization of a mosaic locus in the genome of 'CandidatusLiberibacter asiaticus'

Primer set Sequence (5'-3')
(forward/reverse)
Reference locus in strain Psy62 (CP001677) Annotation Reference
OI1/OI2c GCGCGTATGCAATACGAGCGGCA/GCCTCGCGACTTCGCAACCCAT CLIBASIA_r05781 16S rRNA gene Jagoueix et al., 1994
ITSAf/ITSAr GGGGGTCGTTAATATTTGGTT/GTCGCATACAATGCCAACAT CLIBASIA_r05778 to CLIBASIA_r05781 16S-23S rRNA gene and intergenic sequence Deng et al., 2008
LapGP-1f/LapGP-1r GACATTTCAACGGTATCGAC/GCGACATAATCTCACTCCTT CLIBASIA_01645 bacteriophage repressor protein C1 Chen et al., 2010
Lap5640f/Lap5650r TCTGTGATGCCGTTTGTAGG/CCAAATCAGCCAGCTCAAAT CLIBASIA_05640 to CLIBASIA_05650 Putative transferase This study
  1. PCR amplifications were carried out in 25-μl volumes that include 2 μl of template DNA, 0.4 μl of each 10 μM forward and reverse primer, 2.5 μl of 2.5 mM deoxynucleoside triphosphate, and 0.3 μl of EX Taq DNA polymerase at 5 U/μl (Takara Bio Inc., Japan). Thermal cycling comprised an initial denaturing of 96°C for 1 min, followed by 35 cycles of amplification (96°C for 30 s, 55°C for 30 s, and 72°C for 30 s) and a final extension for 4 min. PCR products were electrophoresed in a 1.5% agarose gel and visualized by ethidium bromide staining under UV light.