Skip to main content

Advertisement

Table 2 Primers used in qRT- PCR of Campylobacter jejuni NCTC 11168

From: Acid stress response and protein induction in Campylobacter jejuni isolates with different acid tolerance

Gene product Forward primer (5′ → 3′) Reverse primer (5′ → 3′)
dps Bacterioferritin TTCATAATCTTGTTTGATCA AAGAGTTTTACAACTTGGCG
cj0706 Unknown GATGAAGAAATCAAAGATATAG CAAGAACTTCCATTTCAGAT
sodB Superoxide dismutase TATCAAAACTTCAAATGGGG TTTTCTAAAGATCCAAATTCT
trxB Thioredoxin- disulfide reductase CAATGTATGCGTTTTGGTT CAAGAACTTCCATTTCAGAT
ahpC Alkyl hydroperoxide reductase GTACTTTATGCAGAAGCAGT CTACCTAGTGGTAAATCATT
mogA Molybdenum cofactor biosynthesis protein ACTTTCTAAGCGCATAAGTTCTCC TACAAGCGGAGGTACAGGTC
p19 19 kDa periplasmic protein GATGATGGTCCTCACTATGG CATTTTGGCGTGCCTGTGTA
fur Ferric uptake regulator ACTCATTACACACCCGAA TCACCACAAACACCATAAAG
lpxC UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase ATGAGTGCGATTAATGCTTA GGCTTTTTAATTACCATAAT
rpoA DNA-directed RNA polymerase subunit alpha GCACCATAGGATATGCTCCAACT CCACGCATGCTATCAAATTCAT