Skip to main content

Table 2 Primers used in qRT- PCR of Campylobacter jejuni NCTC 11168

From: Acid stress response and protein induction in Campylobacter jejuni isolates with different acid tolerance

Gene product Forward primer (5′ → 3′) Reverse primer (5′ → 3′)
lpxC UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase ATGAGTGCGATTAATGCTTA GGCTTTTTAATTACCATAAT