Skip to main content

Table 2 Primer

From: Epidemiological association of Campylobacter jejuni groups with pathogenicity-associated genetic markers

Gene Primer name Sequence 5’-3’ Annealing temp Reference
cj0178 cj0178-F01 TGTAGGCGGGGGTGGCAAGA 54.0°C this study
cj0178-R01 ACGACCGCGAGCAGAATTGC
cj0755/cfrA cj0755/cfrA-F01 ATGGCCGCGAAGTCGTAGGG 54.0°C this study
cj0755/cfrA-R01 AGCGATCTATTTGCCACTCGCCT
cj1321 CjNCTC11168-1321_f AAAATGTCATCATCATAGGAGCG 60.0°C [6]
CjNCTC11168-1321_r TCTAAGTTTACGCAAGGCAACA
cj1322 CjNCTC11168-1322_f GACTTTGGTTTAATGGGTAAGCA 59.6°C [6]
CjNCTC11168-1322_r TTCCGGCGTTAAAATTAGAAAA
cj1323 CjNCTC11168-1323_f AGAACGATTTACCCCATTGAAA 59.7°C [6]
CjNCTC11168-1323_r ATTTGCTAAAGCTCCTCGATTG
cj1324 CjNCTC11168-1324_f TGCCGTAAGTGGAGGTAAAGAT 60.0°C [6]
CjNCTC11168-1324_r TCTGCACACATTGTTCTATCCC
cj1325 CjNCTC11168-1325_f ACGGATTACTTTTTCCAGATGGT 60.0°C [6]
CjNCTC11168-1325_r TTTGCTTTGAAAATACGCTGAA
cj1326 CjNCTC11168-1326_f TACATTTCATCGATAAAGCCGA 59.7°C [6]
CjNCTC11168-1326_r AAATATAATGGTGTGCCGATCC
fucP cj0486FWD GATAGAGCATTAAATTGGGATG 52.0°C [8]
cj0486REV CCTATAAAGCCATACCAAGCC
rpoC GAACTTGCTATTGCTGAGCC
rpsL ACCCTAGTGCAAACTCCCCT
ceuE ceuE-81176F01 GATAGAGTCGCAGGCGTTCC 60°C this study
ceuE405F GATAAAGTCGTTGGCGTTCC [7]
ceuE405R GCGAGATTGGAGGACCAAAGG
pldA pldA-81178F01 AAACTTATGCGTTTTT 45°C this study
pldA-84fwd AAGCTTATGCGTTTTT [7]
pld-981rev TATAAGGCTTTCTCCA
cstII orf7ab ACTACACTTTAAAACATTTAATCC AAAATCA 56°C [14]
orf7ab CCATAAGCCTCACTAGAAGGTATGAGTATA
cstIII orf7c TTGAAGATAGATATTTTGTGGGTAAA 56°C [14]
  orf7c CTTTAAGTAGTGTTTTATGTCACTTGG