Skip to main content

Advertisement

Table 2 Oligonucleotide primers used in this study

From: Opposing roles of σB and σB-controlled SpoVG in the global regulation of esxA in Staphylococcus aureus

Primer name Sequence (5'-3')a reference
esxAdeletion   
oBS43 GGGGACAAGTTTTGTACAAAAAAGCAGGCTacgtttatcaaagacatacc This study
oBS44 gggggtaccaactagaaacctcctgaata This study
oBS45 gggggtaccgcattctgaaattggcaaag This study
oBS46 GGGGACCACTTTGTACAAGAAAGCTGGGTttatccatcgctgtattgtg This study
DIG probes   
Nwmn0219-DIG-f tccagaggaaatcagagcaaa [10]
Nwmn0219-DIG-r cttgttcttgaacggcatca [10]
oSTM29 (spoVGf) gcgtcgacttattgcaaatgtattacatcgc [9]
oSTM43 (spoVGr) gcggagctccactcgtttccattacattagatg [8]
SasarAf agggaggttttaaacatggc [35]
SasarAf ctcgactcaataatgattcg [35]
RNAIII+ gtgatggaaaatagttgatgag [3]
RNAIII- gtgaatttgttcactgtgtcg [3]
arlRSprobe+ tcgtatcacatacccaacgc [36]
arlRSprobe- gagtatgatggacaagacgg [36]
SAasp23+ atgactgtagataacaataaagc [37]
SAasp23- ttgtaaaccttgtctttcttgg [37]
plasmid construction   
Pnwmn0219F tgcggatccgatcacgttgatttgcgtgt This study
Pnwmn0219R-xho tgcctcgagctagaaacctcctgaatattttaag This study
yab-prom-bam-f gcgggatcctgctaatattttaaatttacc This study
yab-prom-xho-r gcgctcgagtactaaaactccttttatgaaaac This study
Pnwmn0219F-hind tgcaagcttgatcacgttgatttgcgtgt This study
Pnwmn0219R tgcccatggctagaaacctcctgaatattttaag This study
pSP-Luc XhoI accggcctcgagatcgatgatatcgaa This study
oBS49 tagttttttaagtatttttagtttttttta This study
oBS51 attcaatatatttatttaaaaaaaactaaaaa This study
oBS53 aggtaccttgagtaaggagcactttttcaa This study
oBS54 aggtaccattcatttttgtaatataaatgtgtatac This study
primer extension   This study
pe_esxA_1 BIOTIN-ccataactagaaacctcctg This study
pe_esxA_2 BIOTIN-tgatttcctctggactcatc This study
esxA_term-r tgcggtaccatgcttatttcctttcagttg This study
  1. aRestriction sites are underlined. Capital letters show the att sites.