Comparative molecular analysis of chemolithoautotrophic bacterial diversity and community structure from coastal saline soils, Gujarat, India

Table 3 Oligonucleotide primers used for PCR amplification of cbbL and 16S rRNA genes

Primer	Position(nt)	Primer sequence(5′-3′)	Reference	PCR amplification¹
Primer	Position(nt)	Primer sequence(5′-3′)	Reference	AS	SS1	SS2
cbbL R1F	634-651	AAGGAYGACGAGAACATC	Selesi et al., 2005 [24]	+	+	+
cbbL R1R	1435-1454	TCGGTCGGSGTGTAGTTGAA	Selesi et al., 2005 [24]	+	+	+
cbbL G1F	397-416	GGCAACGTGTTCGGSTTCAA	Selesi et al., 2005 [24]	-	-	-
cbbL G1R	1413-1433	TTGATCTCTTTCCACGTTTCC	Selesi et al., 2005 [24]	-	-	-
RubIgF	571-590	GAYTTCACCAARGAYGAYGA	Spiridonova et al., 2004 [34]	-	-	+
RubIgR	1363-1382	TCRAACTTGATYTCYTTCCA	Spiridonova et al., 2004 [34]	-	-	+
27 F	27-46	AGAGTTTGATCMTGGCTCAG	Lane, 1991 [35]	+	+	+
1492 R	1471-1492	TACGGYTACCTTGTTACGACT

¹Positive PCR amplification (+), no PCR amplification (−) for the targeted primers in three soil samples.

ISSN: 1471-2180