Skip to main content

Table 3 Oligonucleotide primers used for PCR amplification of cbbL and 16S rRNA genes

From: Comparative molecular analysis of chemolithoautotrophic bacterial diversity and community structure from coastal saline soils, Gujarat, India

Primer Position(nt) Primer sequence(5′-3′) Reference PCR amplification1
AS SS1 SS2
cbbL R1F 634-651 AAGGAYGACGAGAACATC Selesi et al., 2005 [24] + + +
cbbL R1R 1435-1454 TCGGTCGGSGTGTAGTTGAA
cbbL G1F 397-416 GGCAACGTGTTCGGSTTCAA Selesi et al., 2005 [24] - - -
cbbL G1R 1413-1433 TTGATCTCTTTCCACGTTTCC
RubIgF 571-590 GAYTTCACCAARGAYGAYGA Spiridonova et al., 2004 [34] - - +
RubIgR 1363-1382 TCRAACTTGATYTCYTTCCA
27 F 27-46 AGAGTTTGATCMTGGCTCAG Lane, 1991 [35] + + +
1492 R 1471-1492 TACGGYTACCTTGTTACGACT     
  1. 1Positive PCR amplification (+), no PCR amplification (−) for the targeted primers in three soil samples.