Skip to main content

Table 2  rrs  gene based primers used for qPCR quantification and PCR-DGGE

From: Rumen microbial and fermentation characteristics are affected differently by bacterial probiotic supplementation during induced lactic and subacute acidosis in sheep

Target organism Primer set Primer sequences 5' - 3' Assay Reference
Total bacteria 520 F AGCAGCCGCGGTAAT qPCR [14]
  799 R2 CAGGGTATCTAATCCTGTT   
Fibrobacter FibSuc3F GCGGGTAGCAAACAGGAT TAGA qPCR [15]
succinogenes FibSuc3R CCCCCGGACACCCAGTAT   
Ruminococcus RumAlb3F TGTTAACAGAGGGAAGCAAAGCA qPCR [15]
albus RumAlb3R TGCAGCCTACAATCCGAACTAA   
Ruminococcus RumFla3F TGGCGGACGGGTGAGTAA qPCR [15]
flavefaciens RumFla3R TTACCATCCGTTTCCAGAAGC T   
Genus PrevGen4F GGTTCTGAGAGGAAGGTCCCC qPCR [15]
Prevotella PrevGen4R TCCTGCACGCTACTTGGCTG   
Streptococcus StrBov2F TTCCTAGAGATAGGAAGTTTCTTC GG qPCR [15]
bovis StrBov2R ATG ATG GCA ACT AAC AAT AGG GGT   
Genus Lacto 05 F AGC AGT AGG GAA TCT TCC A qPCR [16]
Lactobacillus Lacto 04R CGCCACTGGTGTTCYTCCATATA   
Total bacteria GC + Eub340F CGCCCGCCGCGCGCGGCGGGCGGGGCG GGGGCACGGGGGG TCCTACGGGAGGCAGCAG DGGE [1719]
  HDA2R GTA TTA CCG CGG CTG CTG GCA C