Skip to main content

Table 7 FISH probes targeting 16S rRNA and the hybridization conditions used in this study

From: Diversity and dynamics of Archaea in an activated sludge wastewater treatment plant

Probe Target Target sequence E.coli positions Formamide (%) NaCl (mM) Fluorophore Reference
ARC915 Archaea GTGCTCCCCCGCCAATTCCT 915-934 35 70 Cy5 [73],[74]
MX825 Methanosaetaceae TCGCACCGTGGCCGACACCTAGC 825-845 50 18 Cy3 [73],[74]
EUB338 Bacteria GCTGCCTCCCGTAGGAGT 338-355 35 70 Alexa [75]
EUB338 II Bacteria GCAGCCACCCGTAGGTGT 338-355 35 70 Alexa [75]
EUB338 III Bacteria GCTGCCACCCGTAGGTGT 338-355 35 70 Alexa [75]