Skip to main content

Table 1 Oligonucleotides used in this study

From: A novel transposon construct expressing PhoA with potential for studying protein expression and translocation in Mycoplasma gallisepticum

Oligonucleotide Sequence (5’- 3’)
LNF gcggccgcTTTAGGGGTGTAGTTCAATGG
TSR GTTTTTTCTCTTCATTTTTTTAAATATTTC
TSF GAAATATTTAAAAAAATGAAGAGAAAAAAC
LBR ggatccCCAAACGAACCAATACC
LTNF gccgcggccGCTTTAGGGGTGTAGTTCAATG
SBR TGTAGTACAACTAGCTGCAGCTAACATTACAAAgGAtCCAATACCTAAT
AXPF TTAGCTGCAGCTAGTTGTACTACACCTGTTCTAGAAAACCGGGCT
PBgR CCGaGATcta AAAGGACTGtta TATGGCCTTTTTATTTTATTTCAGCCCCAGA
LTPR CGGTTTTCTAGAACAGGCATTTTTTTAAATATTTC
LTPF GAAATATTTAAAAAAATGCCTGTTCTAGAAAAC
PBaR CTTTTTggatccta TTATTTCAGCCCCAGAGC
IRF GGCCGgGATCAAGTCCGTATTATTGTGTAAAAGTgCtaGc
IRR ggCCgCtaGcACTTTTACACAATAATACGGACTTGATCcC
GmF CCAAGAGCAATAAGGGCATAC
GmR ACACTATCATAACCACTACCG
PRTF ACGAAAAAGATCACCCAACG
PRTR GATCCTTTTCCGCCTTTTTC
HLF TGGTAAGTTAAACGGGATCG
HMR AATGAACCAGTGATTGTTGGA
UBR GCAGTAATATCGCCCTGAGC
  1. Lower case indicates changes made to introduce restriction endonuclease cleavage sites and bold lettering indicates the stop codons.