Skip to main content

Table 3 Oligonucleotides used in this study

From: Analysis of a Clostridium difficile PCR ribotype 078 100 kilobase island reveals the presence of a novel transposon, Tn6164

Name      Sequence     Purpose
1 GAGATATGGTTATGAGATTAGG Presence/absence of insert
2 CCCACCTTTATAGCATCATATAG Absence of insert
3 CTAACCTATCAACTCAACCCC Presence of insert
4 AGGATAAGACCGCAGCAGAA Presence 5’half of insert
5 AAAAACGACGGTTTTCCTGTG Presence 5’half of insert
6 GGGCAAATAGAAAGTCAAAACG Presence 3’half of insert
7 AAGTGGTGTTTTCTTTGGAGGA Presence 3’half of insert
8 CCACAGGGATACCTTTCTCGTGC Presence of tet(44) gene
9 TTCCATATCCTCGGGTTTTTGCAT Presence of tet(44) gene
10 CAGGTGTTGAAATAGATATTGAG Detect 3' end half insert
11 CAGAAGTCGATCCTTTCTGGG Detect 3' end half insert
12 GGTGGCTGAACTCGTTAATC Detect 3' end half insert
13 CTCCACATGGCTCGAGTTG Detect 3' end half insert
14 GAGGAATTTAACAGAACAGTATTT Excision studies
15 TCTATCCTGCCTTCTCAACC Excision studies
16 CGAATCGCTGAAATGACTGA Excision studies
17 GCGAATGATTTCATGGAAGG Excision studies
18 CGACTGCATTACCAGTTCCA Excision studies
Lok1 [13] AAAATATACTGCACATCTGTATAC Transconjugant screening
Lok3 [13] TTTACCAGAAAAAGTAGCTTTAA Transconjugant screening
19 CAGCTGCAGTTTTTCCATGA Transconjugant screening
20 GCAGCTAACGGTGATGACAA Transconjugant screening
Tn916 Fw [30] GACGGAAGATACTTATACA Transconjugant screening
Tn916 Rev [30] GCCTTTGGATTCATTCCTGC Transconjugant screening