Skip to main content

Table 2 Primers used for PCR amplification in the study

From: Association between cagA and vacA genotypes and pathogenesis in a Helicobacter pylori infected population from South-eastern Sweden

Amplicon Primer 5' > 3'1 Size Ref.
VacA (s) M13-SeqS.SE CGTTGTAAAACGACGGCCAGT GACCCTTTGTGCAAAAATCGTT 381 [46]
SeqS.AS CCCARCCTCCATCAATCTT
VacA (i + d) M13-SeqVac.SE CGTTGTAAAACGACGGCCAGT GAGCCAATTCAAYGGCAATTCT 803 [46]
SeqVac.AS CGCTTGATTGGACAGATTGA
VacA (m) M13-SeqM.SE CGTTGTAAAACGACGGCCAGT GAAGTCRTTGATGGGCCTTTTG 717 [46]
VAG-R GCGTCAAAATAATTCCAAGG
CagA/EPIYA M13-cagA.EPIYA.SE TGTAAAACGACGGCCAGT CCCTAGTCGGTAATGG(A/G)TT(A/G)TCT 580-830 [46]
T7-cagA.EPIYA.AS TAATACGACTCACTATAGGGT GTGGCTGTTAGTAGCGTAATTGTC
Empty site CagA M13(−21)_2.SE TGTAAAACGACGGCCAGT ACATTTTGGCTAAATAAAC(A/G)CTG 375 [16]
T7_25.AS TAATACGACTCACTATAGGGT CATGCGAGCGGCGATGTG [4]
CagE M13-CagE.SE TGTAAAACGACGGCCAGT GGGGGAATAGGTTGTTTGGT 385 [45]
  CagE.AS GGATCACCCCATCATCTAAAAA   
  1. 1italic letters, universal tag sequence.