Skip to main content

Table 2 Primers used in the present study

From: A previously uncharacterized gene stm0551 plays a repressive role in the regulation of type 1 fimbriae in Salmonella enterica serotype Typhimurium

Purpose and name Sequence (5′ to 3′) Description
Construction of the stm0551 mutant
stm0551pKD13-F GCTCTGATGTTTCAATGCCTTCCATCAGC ATTAACTGATTCCGGGGATCCGTCGACC Annealing Temp.: 55°C; amplicon length: 1,550 bp
stm0551pKD13-R GGCACAGGGTATTTTGTTAAAGGAAAGG ATAAATCCCTGTAGGCTGGAGCTGCTTCG  
Cloning
stm0551-F GGATCC CATCCTGCTTTTTCCATTGCTCTAATAT Bam HI restriction site (underlined)
stm0551-R GATATC ACTCACTTAACTTTTTACAAGGCTTACG Eco RV restriction site (underlined)
   Annealing Temp.: 55°C; amplicon length: 500 bp
Construction of the fusion protein
stm0551-TOPO-F CACCATGGTGGCACAGGGTATTTTGTTAA Annealing Temp.: 50°C; amplicon length: 316 bp
stm0551-TOPO-R ATATATATCTGGTAATATGGCTGG  
fimY-TOPO-F CACCATGCGCAGCGTACCACGCAG Annealing Temp.: 50°C; amplicon length: 727 bp
fimY-TOPO-R AAAAATGTCGTGGAAAGTAACGT  
E49A-TOPO-F ATCGGCTATGC GGTCCTGACGCAACTTCCG Mutation site (underlined)
E49A-TOPO-R CGGAAGTTGCGTCAGGACCG CATAGCCGAT Mutation site (underlined)
RT-PCR analysis
fimA-RT-F ACTATTGCGAGTCTGATGTTTG  
fimA-RT-R CGTATTTCATGATAAAGGTGGC  
fimZ-RT-F ATTCGTGTGATTTGGCGT  
fimZ-RT-R ACTTATCCTGTTGACCTT  
fimY-RT-F GAGTTACTGAACCAACAGCT  
fimY-RT-R GCCGGTAAACTACACGATGA  
fimW-RT-F AAAGTGAAAGTAAAGCGG  
fimW-RT-R AAGAGATAGATAATGCCCG  
stm0551-RT-F GCCATAAATAACCTTGTTCC  
stm0551-RT-R CATTCATATCTCAACAGCGA  
16 s-F TTCCTCCAGATCTCTACGCA  
16 s-R GTGGCTAATACCGCATAACG