Skip to main content

Table 3 Primers used for the amplification and sequencing of P. verrucosa

From: Occurrence and characteristics of group 1 introns found at three different positions within the 28S ribosomal RNA gene of the dematiaceous Phialophora verrucosa: phylogenetic and secondary structural implications

Primer Sequence (5'-3') 5' position* Source 5' position including ITS
ITS1 TCCGTAGGTGAACCTGCGG -563 White TJ, et al. [48] 1
ITS3 GCATCGATGAAGAACGCAGC -309 White TJ, et al. [48] 255
NL1 GCATATCAATAAGCGGAGGAAA 39 O'Donnell K [49] 603
3PV26 CCGTCTTGAAACACGGACC 633 This work 1197
inFG-F CCGAAAGATGGTGAACTATGCC 795 This work 1359
inF-F ACGTGCAAATCGATCGTCAA 868 This work 1432
inF-R CAAGGCCTCTAATCATTCGCT 1009 This work 1573
8PV26 GAACCTTTCCCCACTTCAG 1487 This work 2051
11PV26 AAGCCATAGGGAAGTTCCGT 1525 This work 2089
9PV26 GTCGTACTCATAACCGCAG 1818 This work 2382
CA-INT-L ATAAGGGAAGTCGGCAAAATAGATCCGTAA 1881 McCullough MJ, et al. [50] 2445
2PV26 TCCCGAAGTTACGGATCTA 1918 This work 2482
16PV26 CCCAACCCTTAGAGCCAATC 1942 This work 2506
10PV26 CCGTACCAGTTCTAAGTTG 2089 This work 2653
inG-F GATGGCCAGAAAGTGGTGTTG 2130 This work 2694
inG-R TAGGGACAGTGGGAATCTCGT 2314 This work 2878
26S-INT3 CTAGCGAAACCACAGCCAAG 2323 This work 2887
CA-INT-R CCTTGGCTGTGGTTTCGCTAGATAGTAGAT 2343 McCullough MJ, et al. [50] 2907
inFG-R GCTCTCCCACCTATTCTACACC 2445 This work 3009
12PV26 TGGTATTTCACCGGCGATTG 2464 This work 3028
IGS1-M-R CTGCCACAAGCCAGTTATC 2805 This work 3369
IGS3-M CTTCGATGTCGGCTCTTCCT 2838 This work 3402
IGS-L TAGTACGAGAGGAACCGT 2991 Williamson ECM et al. [51] 3555
3IGS-PV TCTAAGTCAGAATCCGTGCCG 3090 This work 3654
5IGS1-PV ACGAGCTACTGAGCGTAAG 3318 This work 3882
6IGS-PV GACCACAGTCAGGCTTACG 3349 This work 3913
L2563 F CACAGGGATAACTGGCTTGTGG 2781 This work 3345
L2563R ATCTGAATCAACGGTTCCTCTCG 3018 This work 3582
  1. * The 5' position is relative to the 28S rDNA sequence of the P. verrucosa Yao strain.
\