Skip to main content

Advertisement

Table 2 PCR primers

From: A comparison of the Giardia lamblia trophozoite and cyst transcriptome using microarrays

Gene annotation Locus Sequence* Annealing temperature
histone H2B GL50803_121046 F:CGCCTGATGAAGAAGACG R:GTGTTCCGCTTGCTGA 60
14-3-3 protein GL50803_6430 F:CGGTATGGAAGGCGAGCT R:GCTTGAGGATGTCGTTGC 61
Giardia troph antigen GTA-1 GL50803_17090 F:GCCCGTAGAGTTCTGG R:CGTCACTATCTCCCCG 61
ubiquitin GL50803_7110 F:GTTGAGCCCACAGATACC R:GTTACCACCACGGAGG 61
β-giardin GL50803_4812 F: ATGTTCACCTCCACCC R: CGGAAGTTTGCAGCCA 62
centrin GL50803_6744 F: GCAAACCAAACGCTCG R: CCAGACGTATCCACCTC 61
α-tubulin GL50803_103676 F: CAAGTACATGGCGTGCTGCATGAT R:TAGTTGATGCCGACCTTGAAGCCT 61
SALP-1 GL50803_4410 F: CCGCGCCGACCCCACG R: GCTCATCCAGCATCTTGTCC 61
endothelin-converting enzyme 2 GL50803_4349 F:CATATCACCTTCCTGA R:GACCTGGGAGACATCAATGG 61
mitotic spindle checkpt. MAD2 GL50803_100955 F:GGCTACCCAGACCAAG R:CCCGCCTATCGGAAGA 61
  1. *F, forward primer; R, reverse primer