Skip to main content

Table 2 PCR primers

From: A comparison of the Giardia lamblia trophozoite and cyst transcriptome using microarrays

Gene annotation Locus Sequence* Annealing temperature
histone H2B GL50803_121046 F:CGCCTGATGAAGAAGACG
R:GTGTTCCGCTTGCTGA
60
14-3-3 protein GL50803_6430 F:CGGTATGGAAGGCGAGCT
R:GCTTGAGGATGTCGTTGC
61
Giardia troph antigen GTA-1 GL50803_17090 F:GCCCGTAGAGTTCTGG
R:CGTCACTATCTCCCCG
61
ubiquitin GL50803_7110 F:GTTGAGCCCACAGATACC
R:GTTACCACCACGGAGG
61
β-giardin GL50803_4812 F: ATGTTCACCTCCACCC
R: CGGAAGTTTGCAGCCA
62
centrin GL50803_6744 F: GCAAACCAAACGCTCG
R: CCAGACGTATCCACCTC
61
α-tubulin GL50803_103676 F: CAAGTACATGGCGTGCTGCATGAT
R:TAGTTGATGCCGACCTTGAAGCCT
61
SALP-1 GL50803_4410 F: CCGCGCCGACCCCACG
R: GCTCATCCAGCATCTTGTCC
61
endothelin-converting enzyme 2 GL50803_4349 F:CATATCACCTTCCTGA
R:GACCTGGGAGACATCAATGG
61
mitotic spindle checkpt. MAD2 GL50803_100955 F:GGCTACCCAGACCAAG
R:CCCGCCTATCGGAAGA
61
  1. *F, forward primer; R, reverse primer