Skip to main content

Table 1 List of oligonucleotides used in this study

From: The analysis of para-cresol production and tolerance in Clostridium difficile 027 and 012 strains

Oligonucleotide Sequence
hpdB-IBS AAAAAAGCTTATAATTATCCTTATACCACTAAGCCGTGCGCCCAGATAGGGTG
hpdB-EBS1δ CAGATTGTACAAATGTGGTGATAACAGATAAGTCTAAGCCCATAACTTACCTTTCTTTGT
hpdB-EBS2 TGAACGCAAGTTTCTAATTTCGGTTTGGTATCGATAGAGGAAAGTGTCT
hpdA-IBS AAAAAAGCTTATAATTATCCTTAGGTATCGGCAAAGTGCGCCCAGATAGGGTG
hpdA-EBS1δ CAGATTGTACAAATGTGGTGATAACAGATAAGTCGGCAAATGTAACTTACCTTTCTTTG
hpdA-EBS2 TGAACGCAAGTTTCTAATTTCGATTATACCTCGATAGTGGAAAGTGTCT
hpdC-IBS AAAAAAGCTTATAATTATCCTTATATGTCATGGTAGTGCGCCCAGATAGGTG
hpdC-EBS1δ CAGATTGTACAAATGTGGTGATAACAGATAAGTCATGGTAAGTAACTTACCTTTCTTTGT
hpdC-EBS2 TGAACGCAAGTTTCTAATTTCGGTTACATATCGATAGAGGAAAGTGTCT
EBS universal CGAAATTAGAAACTTGCGTTCAGTAAAC
hpdB-F AATGCCATGGGTAAGTGAAAGC
hpdB-R GAATTGTATAAGTCAACTGAAGAGC
hpdCA-F GTGGATGCAACCAAAGGAAT
hpdC-R TTACAACTCAGTGGACATCCATT
hpdA-R TTAGAAAGCTGTCTCATGAC
RAM-F ACGCGTTATATTGATAAAAATAATAATAGTGGG
RAM-R ACGCGTGCGACTCATAGAATTATTTCCTCCCG
SalI-R1 ATTACTGTGACTGGTTTGCACCACCCTCTTCG
EBS2 TGAACGCAAGTTTCTAATTTCGGTTTGGTATCGATAGAGGAAAGTGTCT