Skip to main content

Advertisement

Table 2 Primers used in this study

From: Identification and characterisation of a novel adhesin Ifp in Yersinia pseudotuberculosis

Primer Sequence
YPTB1572Lux1 TTTCCCGGGCACCTTGGCTGCACCGACTTC
YPTB1572Lux2 TTTGGTACCCGATAGAGACTCATACTTACC
YPTB1668Lux1 TTTCCCGGGCATTTTGGGTGAACACAGAGG
YPTB1668Lux2 TTTGGTACCGAGAAACTCACTGATTGGCTG
YptbIntMBP-1 TCAGAATTCATTAGTGAAGTCACCCCAAC
YptbIntMBP-2 TCATCTAGATGTGCCAGAGCCCTCCTAACC
YptbIntMBP-3 TCATCTAGATTTATTTTATACCCATGTAAAGC
INTPROM3 TTTGGTACCTCAATTACATATCGTTAACGC
INTPROM4 TTTGCATGCGATCTGTCTAAAGAGCGTCG
INTA TTTGCATGCTGGAGTATAGGTAAGTATGAG
INTB TTTGAGCTCGTTTGCACATCGGCTAATGG
YPTB1668Chlor1 CAGGTCCAGCCTTATTCTGTCTCTTCATCTGCATTTGAAAATCTCCATCCTCACTTATTCAGGCGTAGCAC
YPTB1668Chlor4 CGTTCTCCAATGTACGTATCCCGACGCCAAGGTTAAGTGTGTTGCGGCTGCATAGTAAGCCAGTATACACTC
  1. Restriction sites are in bold and position of mutated cysteine to glycine residue is underlined.