Skip to main content

Table 1 Forward (F) and reverse (R) PCR primers employed for molecular identification of all Aspergillus species of section Fumigati and for Aspergillus fumigatus.

From: Rapid identification of Aspergillus fumigatus within the section Fumigati

Primers (5'- 3') Fragment length
Aspergillus section Fumigati β-tubulin F AGGCAGACCATCTCTGGTGAG 153 bp
   R TCGGAGGAGCCATTGTAGC  
  Rodlet A F CCAGGCTCAGCTCTCTTGCT 105 bp
   R CCACCACCGATGAGGTTCTT  
A. fumigatus β-tubulin F TGACGGGTGATTGGGATCTC 198 bp
   R CGTCCGCTTCTTCCTTGTTT  
  Rodlet A F ACATTGACGAGGGCATCCTT 313 bp
   R ATGAGGGAACCGCTCTGATG