Skip to main content

Table 2 Genomic region, primers, and melting temperatures for all genes investigated

From: Novel molecular markers of Chlamydia pecorum genetic diversity in the koala (Phascolarctos cinereus)

Gene Annotation Primer Sequence (5' - 3') Ta Size
Housekeeping Genes   
16S rRNA 16S ribosomal subunit   16S-For CTGAGAATTTGATCTTGG 52°C 1549 bp
    16S-Rev AAAGGAGGTGATCCAGC   
16S/23S 16S-23S intergenic spacer   Spacer-For AAGGATAAGGAAAGCTATCA 54°C 225 bp
intergenic spacer    Spacer-Rev AATTTTTGATCCATGCAAGA   
Membrane Proteins   
ompA Outer membrane protein A 1 ompA-For ATGAAAAAACTCTTAAAATCGG 56°C 1170 bp
    ompA-Rev TTAGAATCTGCATTGAGCAG   
   2 MJFvd3a GGITG(CT)GCAACTTTAGGIGC 50°C 457 bp
    MJRvd4a CACAAGCTTTTCTGGACTTC   
   3 CpeNTVD3b GTTCTTTCTAACGTAGC 46°C 359 bp
    CpeNTVD4b TGAAGAGAAACAATTTG   
omcB Cysteine-rich outer   omcB-For ATGACCAAACTCATCAGAC 54°C 1675 bp
  membrane protein B   omcB-Rev TTAATACACGTGGGTGTTTT   
pmpD Polymorphic membrane   pmpD-For ATGATCAGTCATATACGGAC 56°C 4145 bp
  protein D   pmpD-Rev TTAGAAAATCACGCGTACG   
incA Inclusion membrane   incA-S-Fc TATCGTAATACCAAACCACT 52°C 984 bp
  protein A   incA-S-Rc GTGTGAGATGGCTCTTTATG   
copN Chlamydia outer protein N   copN-For ATGGCAGCTGGAGGGAC 56°C 1191 bp
    copN-Rev TTATGACCAGGGATAAGGTT   
Potential Virulence Genes   
tarP Translocated actin-recruiting phosphoprotein 1 tarP-For ATGACCTCTCCTATTAATGG 56°C 2604 bp
    tarP-Rev CTAGTTAAAATTATCTAAGGTTT   
   2 tarP-2-For AAGAACCAACTCTGCATTATGAAGAGG 54°C 768 bp
    tarP-2-Rev AAGAGGTATTCACGCGACTTCCG   
MACPF Membrane-attack   MAC-For TTGGCGATTCCTTTTGAAGC 58°C 2346 bp
  complex/perforin protein   MAC-Rev TTATAAGCACACACTAGGTCT   
ORF663 Hypothetical protein   663-Fc AAACAACTGCACCGCTCTCT 55°C 1167 bp
    663-Rc GAAGGACTTTCTGGGGGAAG   
  1. 1primers used for initial sequencing of full-length gene from MC/MarsBar/UGT type strain; 2/3 primers used for second-stage sequencing from koala populations for further analysis; aprimers designed by [7]; bprimers designed by [10]; cprimers designed by [26].