Skip to main content

Table 4 The consensus tags from the 16S rRNA gene library.

From: Community analysis of bacteria colonizing intestinal tissue of neonates with necrotizing enterocolitis

Genus/family class typestrain Sequence
Corynebacterium Actinobacteria 10-27 CTTAACGCAGCAAGTCGAACGGAAAGGCCCAAGCTTGCTTGGGTACTCGAGT
Acidimicrobium Actinobacteria 7-54 CTTAACGCAGCAAGTCGGCAAGCGGGTGCGTAACACG
Actinomycetales Actinobacteria C50 AACGATGAAGCCCAGCTTGCTGGGTGGATTAGTGGCGAAC
Bifidobacterium Actinobacteria C35 AACGGGATCCCAGGAGCTTGCTCCTGGGTGAGAGTGGCGAAC
Clavibacter Actinobacteria 9-66 AATGCATGCAAGTCGAACGGTGATGTCAGAGCTTGCTCTGGCGGATCAGTGGCGAAC
Corynebacterineae Actinobacteria B33 AACGGAAAGGCCCTGCTTGCAGGGTGCTCGAGTGGCGAAC
Micrococcineae Actinobacteria B54 AACGATGAAGCCCAGCTTGCTGGGCGGATTAGTGGCGAAC
Propionibacterium Actinobacteria 9-22 AACGGAAAGGCCCTGCTTTTGTGGGGTGCTCGAGTGGCGAAC
Bradyrhizobium α-proteobacteria 7-95 GCAAGTCGAGCGGGCATAGCAATATGTCAGCGGCAGAC
Caulobacter α-proteobacteria 5-10 AACGGATCCTTCGGGATTAGTGGCGGACGGGTGCGTAACACGTGG
Rhodobacteriaceae α-proteobacteria 9-24 AGCGAGGACTTCGGTTCTAGCGGCGGACGGGTGCGTAACACGTGAA
Sphingomonadaceae α-proteobacteria A48 CCTAACGCAGCAAGTCGAACGAACTCTTCGGAGTTAGTGGCGGAC
Bacillales Bacilli 10-49 AATGCATGCAAGTCGAGCGGAGTTGACGAGAAGCTTGCTTCTCGGATGCTTAGCGGCGGA
Enterococcus Bacilli A45 AACGCTTCTTTTTCCACCGGAGCTTGCTCCACCGGAAAAGAGGAG
Exiguobacterium Bacilli 9-61 AGCGCAGGAAGCCGTCTGAACCCTTCGGGGGGACGACGGTGGAATGA
Lactobacillus Bacilli 6-3 CCTAATGCATGCAAGTCGAGCGAGCGGAACCAACAGATTTACTTCGGTAATGACGTT
Staphylococcus Bacilli B55 AGCGAACAGACAAGGAGCTTGCTCCTTTGACGTTAGCGGCGGAC
Bacteroidales Bacteroidetes/Chlorobi group 5-73 CTTAATACATGCAAGTCGAGGGGCAGCATGGTCTTAGCTTGCTAAGGCTGATGGCGACCG
Porphyromonas Bacteroidetes/Chlorobi group 7-33 CTTAACACATGCAAGTCGAGGGGCAGCATTATTTTAGCTTGCTAAGATAGAT
Prevotella Bacteroidetes/Chlorobi group 7-66 TCCTAACGCATGCAAGTCGAGGGGCAGCATGGAAGAAGCTTGCTTCTTCTGATGGCGA
Burkholderiales β-proteobacteria 9-31 AACGGTAACAGGTCTTCGGACGCTGACGAGTGGCGA
Cupriavidus β-proteobacteria A70 AACGGCAGCGCGGGCTTCGGCCTGGCGGCGAGTGGCGA
Ralstonia β-proteobacteria 5-36 AACGGCAGCATGATCTAGCTTGCTAGATTGATGGCGAGTGGCGA
zoogloea β-proteobacteria 10-86 AACGGTAACAGGGAGCTTGCTCCGCTGACGAGTGGCGA
Anaerococcus Clostridia 6-29 AACGATGAAACTTAATTGATTTCTTCGGAATGATTTTAAGTGGATTAGTGGCGG
Clostridium Clostridia C1 AGCGATGAAGCTCCTTCGGGAGTGGATTAGCGGCGGAC
Dialister Clostridia A7 AACGGGAAGAGATGAAGAGCTTGCTCTTTATCGAATCCAGTGGCAAAC
Faecalibacterium Clostridia C42 AACGGAGTTGAGAGGAGCTTGCTTTTCTTGACTTAG
Finegoldia Clostridia 10-63 AACGGGATTTAGTAGACAGAAACCTCGGTGGAAGATTACTAATGAGAGTGGCGAACGGGT
Lachnospiraceae Clostridia A96 AACGAAGCGATTAAGAGGAAGTTTTCGGATGGAATCTTAATTGACTGA
Papillibacter Clostridia C16 AACGGAGCACCTTGAAAGAGACTTCGGTCAATGGATGAGACTGCTT
Peptoniphilus Clostridia 7-94 AGCGATGAAATTTTGACAGATCCCTTCGGGGTGAAGATAAAATGGATTAGCGGCGGA
Ruminococcaceae Clostridia 9-81 AACGGAGTTAATTTTGTTGAAGTTTTCGGATGGATACGAAGTTAACTTAGTGGCGA
Veillonella Clostridia 9-73 AACGGACAGATAGAGAGCTTGCTCTCTTGAAGTTAGTGGCGAAC
Cystobacteraceae Δ-proteobacteria 7-10 AACGCAGCAAGTCGGGTGCGTAACACGTGGG
Acinetobacter γ-proteobacteria 9-10 AACGCAGCAAGTCGAGCGGAGATGAGGTGCTTGCACCTTATCTTAGCGGCGGAC
Enhydrobacter γ-proteobacteria A49 AACGATGATTATCTAGCTTGCTAGATATGATT
Enterobacteriaceae γ-proteobacteria C5 AACGGTAGCACAGAGAGCTTGCTCTCGGGTGACGAGTGGCGGAC
Pseudomonas γ-proteobacteria C19 AGCGGTAGAGAGAAGCTTGCTTCTCTTGAGAGCGGCGGAC
Rickettsiella γ-proteobacteria A22 CCTAACGCAGCAAGTCGAACGGCAGCACAGTAAAGATTTCGGTCTTTAT
Shigella/Escherichia γ-proteobacteria C26 AACGGTAACAGGAAACAGCTTGCTGATTTGCTGACGAGTGGCGGAC
  1. The individual tags (N = 364) were assigned to the closest mono-phylogenetic group.