Skip to main content

Advertisement

Table 1 Specifications of the 16S rRNA primers used in this study

From: Denaturing gradient gel electrophoresis of neonatal intestinal microbiota in relation to the development of asthma

Target group (variable region) Primer designation Primer sequence (5'-3') Amplicon size Annealing temperature DGGE gradient Reference
Universal (V3) F357-GC a 518R TACGGGAGGCAGCAG ATTACCGCGGCTGCTGG 217 55°C 20-70% Muyzer et al., 1993
Universal (V6-V8) U968F-GC a L1401-R AACGCGAAGAACCTTAC CGGTGTGTACAAGACCC 489 55°C 20-70% Zoetendal et al., 1998
Bacteroides fragilis subgroup Bfra 531F Bfra 766R-GCa ATACGGAGGATCCGAGCGTTA CTGTTTGATACCCACACT 293 65°C 20-70% Vanhoutte et al., 2006
Bifidobacterium g-Bifid F g-Bifid R-GCa CTCCTGGAAACGGGTGG GGTGTTCTTCCCGATATCTACA 596 65°C 40-70% Matsukiu et al., 2002
Lactobacillus groupb Lac 1 Lac2-GC a AGCAGTAGGGAATCTTCCA ATTYCACCGCTACACATG 380 61°C 35-60% Walter et al., 2001
  1. a Primers with GC clamp at 5' end: CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCC.
  2. b Lactobacillus group comprising the genera Lactobacillus, Leuconostoc, Pediococcus and Weisella.