Skip to main content

Table 1 Specifications of the 16S rRNA primers used in this study

From: Denaturing gradient gel electrophoresis of neonatal intestinal microbiota in relation to the development of asthma

Target group (variable region) Primer designation Primer sequence (5'-3') Amplicon size Annealing temperature DGGE gradient Reference
Universal (V3) F357-GC a
518R
TACGGGAGGCAGCAG
ATTACCGCGGCTGCTGG
217 55°C 20-70% Muyzer et al., 1993
Universal (V6-V8) U968F-GC a
L1401-R
AACGCGAAGAACCTTAC
CGGTGTGTACAAGACCC
489 55°C 20-70% Zoetendal et al., 1998
Bacteroides fragilis subgroup Bfra 531F
Bfra 766R-GCa
ATACGGAGGATCCGAGCGTTA
CTGTTTGATACCCACACT
293 65°C 20-70% Vanhoutte et al., 2006
Bifidobacterium g-Bifid F
g-Bifid R-GCa
CTCCTGGAAACGGGTGG
GGTGTTCTTCCCGATATCTACA
596 65°C 40-70% Matsukiu et al., 2002
Lactobacillus groupb Lac 1
Lac2-GC a
AGCAGTAGGGAATCTTCCA
ATTYCACCGCTACACATG
380 61°C 35-60% Walter et al., 2001
  1. a Primers with GC clamp at 5' end: CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCC.
  2. b Lactobacillus group comprising the genera Lactobacillus, Leuconostoc, Pediococcus and Weisella.