Skip to main content

Table 2 Primers used in this study.

From: Deletion of the glycosyltransferase bgsB of Enterococcus faecalisleads to a complete loss of glycolipids from the cell membrane and to impaired biofilm formation

  Name Sequence (5'-3')
1 EF2890 delF CAAACTGCTCCTTCAGCAACT
2 EF2890 OEL ACTAGCGCGGCCGCTTGCTCCCTATTTTGTCAGCGCCTCAAC
3 EF2890 OER GGAGCAAGCGGCCGCGCTAGTTAGAAGTCGCTACCCCACTCA
4 EF2890 delR GCGCGACAGTTACCAGAGTAT