Skip to main content

Advertisement

Table 3 Primers used in this work.

From: Housekeeping genes essential for pantothenate biosynthesis are plasmid-encoded in Rhizobium etli and Rhizobium leguminosarum

Primer Sequence (5'- 3')
A GCGGATCCGAAGACCTCAGCAAATACCCGC
B CGGAGGATCCGCGCCACGACGACCGACCCGCC
C CGGGTCTAGACTCGGCATGGTGCTCTATGGCA
D GACGTCTAGAGCTTGAAATCGTTGAAGAGCCC
E TGATGGTACCTTGACGGATGGGGCAATAGCGG
F GGCGCTCTAGAATCCGATGGCGCTCATTTCG
G GCGGGCGGTACCAGCCGGGAAAGGGAGTG
H AAGCGTCTAGAGCCTTCGTCTTACGGCCG
I CGTCAAGGTACCATCCCTTCTGACCGCCTG
J CCCCCTCTAGACGCTGGGGAGAAGGGACTC
K GCTGTGGTACCCGCCGTCCCGGCACTCGCG
L ACCCTTCTAGATGCCGACCTGGAGGGAGG
  1. The restriction sites are indicated in bold.