Skip to main content

Table 1 PCR primers used in this study

From: Lateral gene transfer of streptococcal ICE element RD2 (region of difference 2) encoding secreted proteins

A. Primers used for detection of multiple RD2 genes, Q-PCR and tiling.
Primer name Primer sequence Source
emm sequencing  
CDC emm1 TATT(C/G)GCTTAGAAAATTAA [19]
CDC emm2 GCAAGTTCTTCAGCTTGTTT [19]
Detection of circular form  
#1 GAAAACAAAAGTTTCTTCATGCGTTTGGCG this work
#2 CAATTAATAGAAACATATGGTCATTTG this work
#3 GGAATTAGCCCACTAGAATATAAGC this work
#4 TAGCAAGTAAACCCTAGATTGTCTATGTTC this work
Detection of genes encoding extracellular RD2 proteins  
M28_Spy1306F ACTAAGCCAAGCGAGGACAA [1]
M28_Spy1306R CCAAAACCGTGTAGCCTGTA [1]
M28_Spy 1307F TCATCGTCAAAAGCCATCTC [1]
M28_Spy 1307R TTGCTCTGATAAACCTCAAG [1]
M28_Spy1308F TACGACAGAAGCAGGTGGAG [1]
M28_Spy1308R ACCGAGTTTCGCAGGATTG [1]
M28_Spy1325F TGAATGATGCGGGGACTTAT [1]
M28_Spy1325R TGTAAAAGGCTGCTGGGTCT [1]
M28_Spy1326F ACACCGACTGAGATTGCTGA [1]
M28_Spy1326R TTGGCTTGTGAGGTTTGAGA [1]
M28_Spy1332F ATGCCAAAAACCAAAGGAAG [1]
M28_Spy1332R TCATACTTTTCAGGTACACAAGCA [1]
M28_Spy1336F GATACTTCACAGACGAAACAACG [1]
M28_Spy1336R ATCACGACTCCCATCACTCC [1]
Quantitative PCR (Taqman)  
proS_F TGAGTTTATTATGAAAGAGGCTATAGTTTC [15]
proS_R AATAGCTTCGTAAGCTTGACGATAAT [15]
proS_P TCGTAGGTCACATCTAATCTTCATAGTTG [15]
M28_Spy1306 F CGTTGTTCCTGCTACTGGATCTGCTAC this work
M28_Spy1306 P ACGATTGCAAGTATTGCTTTG this work
M28_Spy1306 R CAATCGGTGTCGTTGGTTG this work
M28_Spy1325 F ACCGTCGCAAGGACCTTGTCTTTCTG [8]
M28_Spy1325 P CAGCATACGCATGACCTC [8]
M28_Spy1325 R AGTGATAACACTACCATCTGATAAAG [8]
M28_Spy1336 F ACAGAAGCTGCACCAAACTTGAACTTCTTAATTGA this work
M28_Spy1336 P GTAGATGCAGCAACTATTGAC this work
M28_Spy1336 R ATGATACTTCACAGACGAAACAAC this work
M28_Spy0784_RD0 F AGCAGAGTATGAAGGCGGTTTT this work
M28_Spy0784_RD0 P ATATTCTATCTGAAACGGCTCG this work
M28_Spy0784_RD0 R AACATCTCTGCGAGTCGTTCTATACTT this work
M28_Spy0980_6180.1 F TCGTTAGGACTGGCGGTAGAG this work
M28_Spy0980_6180.1 P TGCAACTGCTGTCTTAA this work
M28_Spy0980_6180.1 R AACAGTCTTTGCCACCACCAT this work
M28_Spy1087_RD1 F TGTTTTTTGAATCTCTGACTTCTTTCC this work
M28_Spy1087_RD1 P AGAATTGCAGCTACTTGTATT this work
M28_Spy1087_RD1 R TGCAGACGAAAATAGCTGTAACTACTC this work
M28_Spy1231_6180.2 F GCAGTTGCTTGTTGCGTTGA this work
M28_Spy1231_6180.2 P TGCAACCCACTGATTT this work
M28_Spy1231_6180.2 R GCGCGTAGAGCTGGAGTCA this work
M28_Spy1805_6180.3 F AAAGGGCTATGGACGAACGA this work
M28_Spy1805_6180.3 P CAGACCAGCCTTTG this work
M28_Spy1805_6180.3 R GGTAAACCGATATTTTTCATCAATGA this work
B. Primer combinations used for tiling across RD2 element, after [1].
Tiling fragment Amplified region Primer sequence
1 M28_Spy1299-1304 GGTTTCGACAAGGTCAGAGC
   TGTGAGTGTTCCTGTACCAGATG
2 M28_Spy1304-1306 ACGGCTACCTTTCCCCCTA
   ACTAAGCCAAGCGAGGACAA
3 M28_Spy1306-1307 CCAAAACCGTGTAGCCTGTA
   TCATCGTCAAAAGCCATCTC
4 M28_Spy1307-1308 TTGCTCTGATAAACCTCAAG
   TACGACAGAAGCAGGTGGAG
5 M28_Spy1308-1310 ACCGAGTTTCGCAGGATTG
   GCTTGGAGGTGTTTCCTTTC
6 M28_Spy1310-1314 CCTTGTTCTGCTTGATGTCC
   ATCAAGCAAGCAACAAAACG
7 M28_Spy1314-1322 TTTCCACCCATCAGTTCAGG
   GACTGGTGGCGGTAAGACTG
8 M28_Spy1322-1325 TTTCATCCCCAAAAAGCATC
   TGAATGATGCGGGGACTTAT
9 M28_Spy1325-1326 TGTAAAAGGCTGCTGGGTCT
   ACACCGACTGAGATTGCTGA
10 M28_Spy1326-1331 TTGGCTTGTGAGGTTTGAGA
   TCATACTTTTCAGGTACACAAGCA
11 M28_Spy1331-1336 ATGCCAAAAACCAAAGGAAG
   GATACTTCACAGACGAAACAACG
12 M28_Spy1336-1338 ATCACGACTCCCATCACTCC
   CAAAGTTCCTGCCCCAAC