Skip to main content

Table 5 Primers and adaptors used in this study.

From: Comparative genotypic and pathogenic examination of Campylobacter concisusisolates from diarrheic and non-diarrheic humans

Targeta Primer/Adaptor Sequence (5' to 3') Size (bp) Reference
-- Bgl II adaptor1 CGGACTAGAGTACACTGTC -- [38]
-- Bgl II adaptor2 GATCGACAGTGTACTCTAGTC -- [38]
-- Csp6 I adaptor1 AATTCCAAGAGCTCTCCAGTAC -- [38]
-- Csp6 I adaptor2 TAGTACTGGAGAGCTCTTGG -- [38]
-- BLG2F-0 6-fam-GAGTACACTGTCGATCT -- [38]
-- CSP61-A GAGCTCTCCAGTACTACA -- [38]
Universal 16S rRNA gene UNI27F AGAGTTTGATCCTGGCTCAG -- [37]
  UNI338F ACTCCTACGGGAGGCAG -- [37]
  UNI1100R AGGGTTGCGCTCGTTG -- [37]
  UNI1492R TACGG(C/T)TACCTTGTTACGACT -- [37]
C. concisus 23S rRNA gene MUC1 (forward) ATGAGTAGCGATAATTGGG -- [11]
  CON1 (reverse) CAGTATCGGCAATTCGCT 306 [11]
  CON2 (reverse) GACAGTATCAAGGATTTACG 308 [11]
C. concisus cpn gene
(primary primers)
Ccon-cpn_66f TATCGAAGTGAAACGTGGCA 357 [35]
  Ccon_cpn_423r GCTCAAGCACTGGCAATAAG -- [35]
C. concisus cpn gene
(nested primers)
Ccon_cpn_72f AGTGAAACGTGGCATGGATA 270 [35]
  Ccon_cpn_342r GCATCTTTTCAGGGTTTGTG -- [35]
C. concisus S-layer RTX gene
(YP_001465940.1)
FCCC13826_1838 ACAGGCCATAAGTGGATTGC 374 This study
  RCCC13826_1838 CCGTCATAGTGGGCTCTCAT -- This study
C. concisus zot gene
(YP_001467422)
FCCC13826_2075 TGCAAACCCTTTGTGATGAA 355 This study
  RCCC13826_2075 CATGAGCCAGCTCAATCAAC -- This study
Human interleukin 8 gene
(NM_000584)
hIL-8f TTTTGCCAAGGAGTGCTAAAGA 194 PB b
  hIL-8r AACCCTCTGCACCCAGTTTTC -- PB b
Human C1orf33 gene
(NM_016183)
hC1orf33f TCCAAGCGCGACAAGAAAGT 102 PB b
  hC1orf33r GTAGGTGTCCACACATTTCCG -- PB b
C. jejuni CDT B gene
(U51121)
P5 GAATCCGTTGGCACTTGGAATTTGCAAGGC 495 [40]
  P6 GGATTCGTTAAAATCCCCTGCTATCATCCA -- [40]
  1. a GenBank or NCBI protein accession number indicated in brackets.
  2. b Primers sequences were obtained from the PrimerBank database http://pga.mgh.harvard.edu/primerbank/index.html