Skip to main content

Table 2 Oligonucleotide primers used in this study

From: Quinolone resistance in Escherichia coli from Accra, Ghana

Target gene Primer Primer Sequence Purpose Reference
gyrA gyrA12004 TGC CAG ATG TCC GAG AT gyrA QRDR amplification [12]
  gyrA11753 GTA TAA CGC ATT GCC GC   
parC EC-PAR-A CTG AAT GCC AGC GCC AAA TT parC QRDR amplification [43]
  EC-PAR-B GCG AAC GAT TTC GGA TCG TC   
qnrA qnrA-1A TTC AGC AAG ATT TCT CA qnrA detection [42]
  qnrA-1B GGC AGC ACT ATT ACT CCC AA   
qnrB qnrB-CS-1A CCT GAG CGG CAC TGA ATT TAT qnrB detection [42]
  qnrB-CS-1B GTT TGC TGC TCG CCA GTC GA   
qnrS qnrS-1A CAA TCA TAC ATA TCG GCA CC qnrS detection [42]
  qnr-1B TCA GGA TAA ACA ACA ATA CCC   
qepA qepA-F GCAGGTC CAGCAGCGGGTAG qepA detection [41]
  qepA-R CTTCCTGCCCGAGTATC GTG   
adk adkF ATTCTGCTTGGCGCTCCGGG MLST [19]
  adkR CCGTCAACTTTCGCGTATTT   
fumC fumCF TCACAGGTCGCCAGCGCTTC MLST [19]
  fumCR GTACGCAGCGAAAAAGATTC   
gyrB gyrBF TCGGCGACACGGATGACGGC MLST [19]
  gyrBR ATCAGGCCTTCACGCGCATC   
icd icdF ATGGAAAGTAAAGTAGTTGTTCCGGCACA MLST [19]
  icdR GGACGCAGCAGGATCTGTT   
mdh mdhF ATGAAAGTCGCAGTCCTCGGCGCTGCTGGCGG MLST [19]
  mdhR TTAACGAACTCCTGCCCCAGAGCGATATCTTTCTT   
purA purAF CGCGCTGATGAAAGAGATGA MLST [19]
  purAR CATACGGTAAGCCACGCAGA   
recA recAF CGCATTCGCTTTACCCTGACC MLST [19]
  recAR TCGTCGAAATCTACGGACCGGA   
  1. MLST - multi-locus sequence typing; QRDR - quinolone-resistance determining region