Skip to main content

Table 1 Genes tested in both computational and biochemical assays

From: Phenotypic and transcriptional analysis of the osmotic regulator OmpR in Yersinia pestis

Gene ID Gene Regulation Computational matching of regulatory consensus Position of DNA fragment used §
    Position§ Sequence Score LacZ Footprinting
YPO1222 ompC + D-110...-91 ATAAATACTTGTTGCAATTT 7.06 -379...+130 -245...+31
YPO1411 ompF + R-99...-80 TTTACATTTTGTAACACATA 11.57 -328...+143 -389...+69
YPO2506 ompX + R-82...-63 GAAATTCTTTGTTACATGAA 6.03 -374...+123 -191...+89
YPO0136 ompR + D-81...-62 AATAAGCTTTGTAACAATTT 10.34 -409...+83 -238...+14
  1. §, The numbers indicate the nucleotide positions upstream of the transcription start sites
  2. +, positive and direct regulation
  3. -, negative and direct regulation