Skip to main content

Advertisement

Table 2 Primers used in this study

From: pBAM1: an all-synthetic genetic tool for analysis and construction of complex bacterial phenotypes

Name Sequence 5' → 3' Usage Reference
ARB6 GGCACGCGTCGACTAGTACNNNNNNNNNNACGCC PCR round 1 [59]
ARB2 GGCACGCGTCGACTAGTAC PCR round 2 [59]
ME-O-extF CGGTTTACAAGCATAACTAGTGCGGC PCR round 1 This work
ME-O-intF AGAGGATCCCCGGGTACCGAGCTCG PCR round 2/sequencing This work
ME-I-extR CTCGTTTCACGCTGAATATGGCTC PCR round 1 This work
ME-I-intR CAGTTTTATTGTTCATGATGATATA PCR round 2/sequencing This work
GFP-extR GGGTAAGTTTTCCGTATGTTGCATC PCR round 1 This work
GFP-intR GCCCATTAACATCACCATCTAATTC PCR round 2/sequencing This work