Skip to main content

Table 3 Oligonucleotides used

From: Role of ZnuABC and ZinT in Escherichia coliO157:H7 zinc acquisition and interaction with epithelial cells

Primer Sequence(5'-3')
ZinT-HP1 TTTAGGTGTCTTTATTGTTAGCGCTCCTGCCTTTTCGCATTGTAGGCTGGAGCTGCTTCG
ZinT-HP2 CCACTTCTTCGCTACTCAACTGATATGGATAATACGTTGGCCCATATGAATATCCTCCTTAG
ZnuA-HP1 ATTATTCGCCGCTCTCTGGGGCGGTGCAACACAGGCCGCTGTAGGCTGGAGCTGCTTCG
ZnuA-HP2 CCTTTCAGGCAGCTCGCATACTGGTTGGCTAATTGACTCAGGCATATGAATATCCTCCTTAG
Zur-HP1 AAATCTGCGCGCAGCGTAATGTGCGCCTGACCCCACAGCTGTAGGCTGGAGCTGCTTCG
Zur-HP2 GCACAGAGTGATCATGCTGGCACTGTTCAGGATGACGACACGCCATATGAATATCCTCCTTAG
EtpC-HP1 ATAAAAGATATCGTACTTAAAATGCTGACGCCAAACCGGCTGTAGGCTGGAGCTGCTTCG
EtpC-HP2 CAGCAATAAATGCATCATATAACTGACCATCACGCTCGACCATATGAATATCCTCCTTAG
EtpD-HP1 TTTATGGTTTTGCTGTGGTCGATATGCACAACGGTATACTTGTAGGCTGGAGCTGCTTCG
EtpD-HP2 GCATAAAACGCAGCAATCGCCGCTTTCACCTTCCGGAAAGCATATGAATATCCTCCTTAG
ZinT-3xFLAGF GTTGAGTAGCGAAGAAGTGGTCGAGGAAATGATGTCTCATGACTACAAAGACCATGACGG
ZinT-3xFLAGR CTTTCTCTGTTGGCCGTATTGTGTATGGAATCCGTTATTGGCATATGAATATCCTCCTTAG
ZnuA-3xFLAGF TCAATTAGCCAACCAGTATGCGAGCTGCCTGAAAGGAGATGACTACAAAGACCATGACGG
ZnuA-3xFLAGR TGACAATTGGCGTGGCATCGCGGTGATAAACATAGGGCCGCATATGAATATCCTCCTTAG
ZnuAO157-Pst-F AACTGCAGTGTCGACTTACCTGCG
ZnuAO157-Xba-R GCTCTAGATTATTAAACGCCAGGGCGA
ZnuA E coliKpn-F GGGGTACCGTTACATAAAAAAACGCTTC
ZnuA E coliXba-R GCTCTAGATTAATCTCCTTTCAGGCAG
Clo-Inta CTGGATATACCACCGTTGAT
Stop Clo-Inta CACTCATCGCAGTACTGTT
Kan-Fa TGAACAAGATGGATTGCACG
Kan-Ra AAGAACTCGTCAAGAAGGC
  1. P1, P2 and 3xFLAG homolog sequences are underlined
  2. a primers used for screening of mutant clones or in Southern experiments