Skip to main content

Advertisement

Table 2 Primers used for qRT-PCR in this study

From: Impact of sub-inhibitory antibiotics on fibronectin-mediated host cell adhesion and invasion by Staphylococcus aureus

Primer name 5' 3' sequence Reference
gyrB F GGTGGCGACTTTGATCTAGC [14]
gyrB R TTATACAACGGTGGCTGTGC [14]
fnbA F ATTGAGACATTTAATAAAGCGA [15]
fnbA R TTTTGAATAATCGGACCATT [15]
fnbB F CACCGAAAACTGTGCAAGCA [16]
fnbB R TTCCTGTAGTTTCCTTATCAGCAACTT [16]