Skip to main content

Advertisement

Table 1 Primers used in the real-time PCR experiments.

From: The small heat shock proteins from Acidithiobacillus ferrooxidans: gene expression, phylogenetic analysis, and structural modeling

Target gene Forward primer (5' → 3') Reverse primer (5 '→ 3') Amplicon length (bp)
Afe_1009 CCGAAATACCTGAGGTCAA TCCCTTTCTCCTCCTTCTCC 91
Afe_1437 GTATTGAAGGCGGAGATTGC TCTTCTTCCTTGACGCCACT 118
Afe_2172 AGGTAATCTTCAGCGGCAAC TAGGGGATCTCCAGACGATG 97