Skip to main content

Table 2 Primers

From: The alkylation response protein AidB is localized at the new poles and constriction sites in Brucella abortus

Name Sequence 5' to 3' Usage
attB1 ggggacaagtttgtacaaaaaagcaggct Sequencing of coding sequence after ORFeome screening
attB2 ggggaccactttgtacaagaaagctgggt Sequencing of coding sequence after ORFeome screening
acoDHP1 tagcaaatgcagtgcaag PCR amplification for checking aidB disruption
pGEM-T-aval ggaaacagctatgacca PCR amplification for checking aidB disruption
AcoA gcggcttacgggccataaa Amplification of B. abortus aidB internal fragment
AcoB gctgctcgaccaaaggcttg Amplification of B. abortus aidB internal fragment