Skip to main content

Table 1 Primers for qPCR analysis

From: An alternative physiological role for the EmhABC efflux pump in Pseudomonas fluorescens cLP6a

Gene Forward primer (5' → 3') Reverse primer (5'→ 3')
emhA CGGTGAGCCGTCAGGAATAC TTGATCTGGGCGCTTTGC
emhB GTCCCACTGGCGATTTCC CCGTGATCATACCGCCAATAA
emhC GATCGCCTGGCGCAACT CTTTCGCAGTCTGCTCATTCC
16S rRNA GGAGACTGCCGGTGACAAACT TGTAGCCCAGGCCGTAAGG