Skip to main content

Table 1 Primer sequences used in this study

From: The bacteriophage WORiC is the active phage element in wRi of Drosophila simulans and represents a conserved class of WO phages

ORF Product Locus Tag Specificity Sequence (5'-3')
Superoxide Dsim GD12822 D. simulans F - GTCGACGAGAATCGTCACCT
Dismutase (SOD)    R - GGAGTCGGTGATGTTGACCT
Surface Antigen WRi 010990 Wolbachia F - ATCAGGGTTGATGTTGAAGG
Wsp (Wsp)   w Ri R - CAGTATCTGGGTTAAATGCTG
Lyzozyme M1 WRi 012650 WORiA F - GACTTTATGGCAGTATACCGA
(Lyz)    R - TGTTCCGTTGAATTTGTTCC
DNA WRi 005640 WORiB F - CTTAAATGACCATCAACCACAG
Methyltransferase (MTase)    R - GCTTCAATCAGGGAATTTGG
Contractile Tail WRi 006970 WORiC F- GTTGATGGTAGAGGTTATGCAG
Tube Protein    R - GAATATCCATACCACCAGCTC