Skip to main content

Advertisement

Table 5 Primers designed for the expression of VP1s and VP4s

From: Comparing Enterovirus 71 with Coxsackievirus A16 by analyzing nucleotide sequences and antigenicity of recombinant proteins of VP1s and VP4s

primers sequences endonuclease fragments (bp)
EV71-VP1-2F 5'- ACGGATCCGGAGATAGGGTGGCAGAT -3' BamH|  
EV71-VP1-2R 5'- CCTCTCGAGTTAAAGAGTGGTGATCGCTGTG -3' Xho| 911
EV71-VP4-2F 5'-CCGAATTCATGGGCTCGCAAGTG-3' EcoR|  
EV71VP4-2R 5'-TCTCTCGAGTTACTTCAGCGGCGCTGC-3' Xho| 227
CA16-VP1-2F 5'- GAAGATCTGGGGGATCCTATCGCAGAC-3' BamH|  
CA16-VP1-2R 5'- CCGCTCGAGTTACAGTGTTGTTATCTTG-3' Xho| 912
CA16-VP4-2R 5' -CGCCGAATTCATGGGGTCACAAGT -3' EcoR|  
CA16-VP4-2F 5'- TATCTCGAGTTACTTGAGCGGCGGG -3' Xho| 229
  1. F referred as forward primer and R referred as reverse primer.