Skip to main content

Table 3 Primers used in this study

From: Mobilisation and remobilisation of a large archetypal pathogenicity island of uropathogenic Escherichia coli in vitrosupport the role of conjugation for horizontal transfer of genomic islands

Designation Sequence (5` - 3`) Comment and reference
  Primers for the mobilisation experiments  
Cm_fw_PstI CTGCAGGCTTGTCAGGGGGGCGGAG cat cassette in pGP704
Cm_rev_PstI CTGCAGACCCTGCCCTGAACCGACGA "
pir_fw_SacI TTTGAGCTCCCGTCAAGTCAGCGTAATGCTC Introduction of a stop codon into pir
pir_revStop_ EcoRI TTTGAATTCTCAAGCTTCATCATCTTTATCGCCAGA "
paiII_1XhoI TTTCTCGAGGGGAAGCACGATATGCAGCC Labelling of PAI II536 by homologous recombination with pSG704
paiII_1SacI TTGAGCTCGATATTTTTTGGCTGCTTCAGCTTTACG "
paiII_2SacI TTTGAGCTCGGACAAGAACACAAAATCACTCTACTGA "
paiII_2XhoI TTTCTCGAGCCCGGCTTCATCGACAATGA "
ATT1 GAGGTACCAGCGCGGTTTGATC Confirmation of pir integration into the λ attachment site (E. coli)
ATT2 CAGATGGCGCAATGCCATCTGG "
17 kD up CCCGGCTGAACAGACGATT Screening PCRs for PAI II536
17 kD in GCAGCGGAGAGTCATTGTC "
hlyDup CGCGATAATCCGCTACATC "
hlyDin GGGTATGGCTGTCACTGCA "
hec_down1 CACACTGAAAGGCCGCAGC "
hec_down2 GTACAGCGTGCCGTTCTGC "
dsdXin GCTGTATCCCGACATCAGC "
dsdAup GCCACATCATTCTCCCGTA "
ORFAin CATCCCCTTCACTACAGGA "
Na-Anti_pdo CAGCGATGCTGGACCGTAT "
PaiII_1fw CAACCGTAGAAATACGTGCCG Overlapping PCRs of PAI II536
PaiII_1rev CCAGTATGAGGCAAACCCTAAAG "
PaiII_2fw GACAATAGCTGTCCATACGGTG "
PaiII_2rev CAATGCTGGCCATATCCATCAG "
PaiII_3fw GACTCACTACTGGGAAGGTC "
PaiII_3rev GATGGTCATGTGCAGGGAGG "
PaiII_4fw GTGATGTCACTGGCGGTAATAATC "
PaiII_4rev GGCGATGACCATGATACGGTA "
PaiII_5fw CGGAATACTGAACTGCGGATAA "
PaiII_5rev GCTGGATGCCAATCAATGATCG "
PaiII_6fw GCATCCATCTCCGTTCACAG "
PaiII_6rev GCATGGCTGGTTGTTCCTAAAC "
PaiII_7fw CCTCCTTTGGACTGAAGTTCA "
PaiII_7rev GCACAGGCGCTCTTTTATTGTTTG "
PaiII_8fw GGACACATGGCAGGGTCTG "
PaiII_8rev GGAACACGTCTTCTTGTTGACA "
PaiII_9fw CAGCGATTTGTCACCACCTG "
PaiII_9rev GTACTTGACGCGGCGGACA "
PaiII_10fw GCTTCTGAAAAACGGGTGAAGTC "
PaiII_10rev CATGGCGCATCATGAAATCATCA "
PaiII_11fw CTCTCGCGTATATTCAGCAAAAAC "
PaiII_11rev CGTCACATCGGATAACATTCGG "
PaiII_12fw CTGATATCTCTTTCAGACTTCAGAAC "
PaiII_12rev GTCACCTCAAGAACGTCTAACC "
PaiII_13fw CTGGCACCTATGGATCAGGT "
PaiII_13rev GTTCAGCAACTGAAGGTTCATACT "
PaiII_14fw GATGACCATCAGTGTTTCCGCT "
PaiII_14rev CGGGGATTTAAGTATTGGTCAGTT "
PaiII_15fw GCAACAATCTGACCTGCAAGCAT "
PaiII_15rev GGATGATGAGCTTCAGGTTCAG "
PaiII_16fw TGCCGTACAGCTTGTCATTACC "
PaiII_16rev CTGGGTACTGCACTTTCCTCA "
PaiII_17fw CTGACATTGCCACCAGATTTTTGT "
PaiII_17rev GGTGTAATGCGCTAACCTGTTTC "
PaiII_18fw CTACAAATGTTCAATATGGTGGGTATATC "
PaiII_18rev CGCTGTTGCCACTGGATTAATG "
PaiII_19fw GCCATCCACTACATATCATGCC "
PaiII_19rev CGACGGGTTTCTATGCTGAG "
PaiII_20fw CCTCAACTGGAGCAATTTTCTGTC "
PaiII_20rev GGACTTGGATCACTGAAGCTTTAC "
PaiII_21fw CCACAAGCTGTTGATTTTGGTACG "
PaiII_21rev GCGATAGTGGGCAATTTGCTATTG "
PaiII_22fw CGTAAACGTCCTCCAGAATTTATATC "
PaiII_22rev GGACGATGGCGATATGTCTG "
PaiII_23fw GTTCTTCATTTCTACGTTGCTTTGTC "
PaiII_23rev CCTACCAGAGATAACCCATGG "
PaiII_24fw CGGTTTCTCCTGAACATAACTTTG "
PaiII_24rev GGTGAAGTCCGTAACCAGAATG "
PaiII_25fw GCCTGTTTTTGCTGCTGTTCAC "
PaiII_25rev GCAGGACTAAAGTTGCAGAGC "
PaiII_26fw CGCTTTCGCCCCGATTTCTA "
PaiII_26rev ATGACCGTCGTACTGTGGAC "
PaiII_27fw GTCAGCCCGCTTTTCTTCTG "
PaiII_27rev GCTCCGTCGTATACCGATGA "
PaiII_28fw CGGTCAAGAAAATACGATGAGCC "
PaiII_28rev GAACGACAGCAAAATCCTCTCC "
PaiII_29fw CAGCACCTGCGCCGTCA "
PaiII_29rev GCGATGCCACGGTGAAAACC "
PaiII_30fw CCGGTATTACTGAATGTCCCG "
PaiII_30rev GAACATGAAGACAGCACTGACC "
PaiII_31fw CCTGAAGCAGAACATCATCCAG "
PaiII_31rev CGGCTGATATCCTGAGACTG "
PaiII_32fw CTCGCTTCCACGGACGTTG "
PaiII_32rev GTTGGCAGTGCTGAAAGCAG "
PaiII_33fw GGTCAGAATGTCCTCAGTGAG "
PaiII_33rev CAATGAAATTGACAGGAGAGATACC "
PaiII_34fw CCACTGGCATGATTTTTACCCTG "
PaiII_34rev CGGGCACATTCCTGCTGTC "
PaiII_35fw GGATACTGGGCGATGAGCG "
PaiII_35rev GAGCACGGTGAGCGAAATAG "
PaiII_36fw CCGCATTAGGTGACTTTACACG "
PaiII_36rev GACGCCGTACTGACCGATG "
PaiII_37fw CCAGGTTTGTTATCGAGGTAAGG "
PaiII_37rev GGCGCTATCGACTACGTCC "
PaiII_38fw GGCAGTATATCGATTCGGCGA "
PaiII_38rev GCTTCCCAGCCTGTCACTTC "
PaiII_39fw GGGCATCTTCAAAGTCAAAGCC "
PaiII_39rev CGCCCGTCTGTTTTTCAGTTTC "
PaiII_40fw GGGGCATCAAGGTCGCTATTT "
PaiII_40rev CAGAACCGCAGCCAGCCAT "
PaiII_41fw GCTGCGATGCGGATCCAC "
PaiII_41rev GGTTACCGCAATGGTGAAAGG "
PaiII_42fw GCTTTTACTGCGCCGACATCA "
PaiII_42rev CGTTGCACGCGGCTATCTG "
PaiII_43fw CGATGGATACATTCGGGTTTAGC "
PaiII_43rev GCAACAGCGACATCATCCTG "
PaiII_44fw CTCTCTCTTCAGCCAGTCATC "
PaiII_44rev GCCAAAATCTGATCCCCAGC "
PaiII_45fw GCAACTACGCCATTGGTTTGTC "
PaiII_45rev GAAAAACTGGCACGTCATCAACG "
PaiII_46fw GAAGGCTGCCATTCGGGTATA "
PaiII_46rev CTGTACTGACTCGTCAGCACT "
PaiII_47fw CTTGAGATTCAGCAAGGTGGC "
PaiII_47rev GGAATCCCCTAATGCTGGTG "
PaiII_48fw GTATAACGGGATGAAAGTGGGG "
PaiII_48rev GTTGAGAATGTCGGGAATGGTAC "
PaiII_49fw GGATGTGTATCAGACAAAGCAATG "
PaiII_49rev TTTCTGGCGAATTTCTTCAGGAAG "
PaiII_50fw CAGCCATTTTTCCCTCTCCG "
PaiII_50rev CCTGACCATCTTCCGTCATG "
PaiII_51fw CTGCTGTTCACTGTGGCATC "
PaiII_51rev GAGTGGCAACCAGTTGAGACT "
PaiII_52fw CGCATAATTCCACCACACCTTC "
PaiII_52rev GGCTGGTCGGTACGCAC "
PaiII_53fw GGCAGGCATTTCACTGTGTGA "
PaiII_53rev CGAAGGCCGGACTCGAACA "
K12R (rev) ATCCTGCGCACCAATCAACAA E. coli K-12 specific [67]
K12L (fw) TTCCCACGGACATGAAGACTACA "
K12IS-L (fw) CGCGATGGAAGATGCTCTGTA "
orf4bico GGAATGAATGCCACTCCATTATTGACAGAAATG E. coli 536 (K15 capsule)- specific
orf5bico GATCAAACGAGTCAGCTAAATAATCCCCAC E. coli 536 (K15 capsule)- specific
M803b GCCTGGAGTGTGACAAAGGTTAC leuX flanking primers [17]
M805c GATGTTCACCAAGGTGGGCGT "
leu 2 ACCAAGCGCTGCAAAAAGAT Concatemer PAI II536
Concat 1 CCGGATTGGATCTATCGCGA "
yjgB1 ACTTTATCGGCACCCATCG Downstream of leuX
yjgB2 GCATGAGGTGATTGGGCG "