Skip to main content

Table 2 List of primers

From: A new class of IMP dehydrogenase with a role in self-resistance of mycophenolic acid producing fungi

Name Sequence (5' → 3')
BGHA236 HC ATGCCIATYNCCRMCGGIGAYKC
BGHA246 HC CRGCCTTCTTRTCCTCCATGG
BGHA240 HC ATGGTCGADRTYCWGGAYTAYACC
BGHA241 HC GARGCRCCRGCGTTMTTG
BGHA343 GAGCGYATGARYGTYTAYTTCA
BGHA344 GTGAACTCCATCTCRTCCATACC
BGHA70 TTAACACAATTGCGCGGTTTTTTGGGGTAGTCATC
MfeI
BGHA71 TTAACACCTGCAGGCGCGGTTTTTTGGGGTAGTCATC
SbfI
BGHA125 TTAACAGGGTACCAAGTCAATTTTCACCAATCAAGC
KpnI
BGHA132 TGGTATGCGATCGCGTCAGAGTCAAACAAAGCCAGA
AsiSI
BGHA168 GGGTTTAAUACAGACGAAAGGGTTGTTGG
BGHA169 GGACTTAAUGTCTCTATCAGGACACGCAGA
BGHA170 GGCATTAAUTGGCTTTCTTTTCGTTTCTTG
BGHA171 GGTCTTAAUTGCTTCTGCAATTTCGACAC
BGHA98 GGTTTCGTTGTCAATAAGGGAA
BGHA256 HC CATGGAGGGCTTCCAGAATA
BGHA255 HC TTTTGCTGTGCTGTAGTCGTG
BGHA225 CCAGTTATCTGGGCAAACCAAAAG