Skip to main content

Table 2 Oligonucleotide primers for Real-Time PCR detection of genes encoding for resistance to vancomycin (vanA, vanB, vanC1, vanC2), tetracycline (tet(L), tet(M), tet(S)), ciprofloxacin (gyrA), ampicillin (pbp5) and gentamicin (aac(6')-aph(2'))

From: SNP diversity of Enterococcus faecalis and Enterococcus faecium in a South East Queensland waterway, Australia, and associated antibiotic resistance gene profiles

Target gene Primer name Primer sequence (5' to3') Positive control
van A vanAFa TGTGCGGTATTGGGAAACAG ATCC 51559
  vanARb GATTCCGTACTGCAGCCTGATT  
van B vanBF TCTGCTTGTCATGAAAGAAAGAGAA ATCC 700802
  vanBR GCATTTGCCATGCAAAACC  
tet(L) tetLF GGGTAAAGCATTTGGTCTTATTGG RBH200523
  tetLR ATCGCTGGACCGACTCCTT  
tet(M) tetMF GCAGAATATACCATTCACATCGAAGT RBH200535
  tetMR AAACCAATGGAAGCCCAGAA  
tet(S) tetSF CCATTGATATCGAAGTACCTCCAA RBH200535
  tetSR AGGAAGTGGTGTTACAGATAAACCAA  
gyr A gyrAF CGGATGAACGAATTGGGTGTGA ATCC 51559
  gyrAR AATTTTACTCATACGTGCTT  
pbp 5 pbp5F GTTCTGATCGAACATGAAGTTCAAA ATCC 51559
  pbp5R TGTGCCTTCGGATCGATTG  
aac(6')-aph(2') acc-aphF TCCTTACTTAATGACCGATGTACTCT ATCC 700802
  acc-aphR TCTTCGCTTTCGCCACTTTGA  
  1. Fa forward primer, Rb reverse primer