Skip to main content

Table 2 Primers used in this work

From: The hyl Efm gene in pHylEfm of Enterococcus faecium is not required in pathogenesis of murine peritonitis

Primer Sequence (5'-3') Relevant Characteristics
A gaagatctgagataggttatgcaagat Forward, BglII site (underlined), used amplification of aph-2"-ID
B ccaatgcatgattccggattctaaaaaagg Reverse, NsiI site (underlined), used amplification of aph-2"-ID
C cgggatccgtttaaaaccagctggaaaag Forward, BamHI site (underlined), located 1,251 nucleotides upstream of the start codon of the gene encoding a putative glycosyl hydrolase family 20 (Figure 1.)
D ccgctcgagcaattcaacattgcaaagac Reverse, XhoI site (underlined), located 294 nucleotides upstream of the start codon of the gene encoding a putative glycosyl hydrolase family 20 (Figure 1.)
E cgagggcccgtgaagtattgccagatgt Forward, ApaI site (underlined); located 592 nucleotides downstream of the down gene (hypothetical, Figure 1.)
F ccggaattcaaaagcagaattggaaatca Reverse, EcoRI site, 1,571 nucleotides downstream of the down gene (hypothetical, Figure 1.)
G gcgagctcgattactttcaaaggaga Forward, SacI site (underlined), ribosomal binding site of hyl Efm (italics) (Figure 1.)
H tcccccggg ctaacttttgataatttgctc Reverse, SmaI site, (underlined) and stop codon of hyl Efm (Figure 1.)
I tcccccggg ttagcgattgatcgagc Reverse, SmaI site (underlined), stop codon of down (Figure 1.)
J cgggatcccaatcaagaagtagcggatt Forward, BamH site (underlined) 438 nucleotides upstream of the stop codon of carbohydrate ABC transporter gene (Figure 1.)
K gcggccgctcgagggcccttagtgcgattgtatctgac Reverse, stop codon of the gene that encodes to transmembrane protein (Figure 1.)
L gggcccctcgaggcggccgcaaaattaaataaaaaatgg Forward, ApaI, XhoI, NotI site, stop codon down (Figure 1.)
M catgcatgaatcaggaactgaaactgc Reverse, NsiI site, 1,091 nucleotides upstream of stop codon of GMP synthase (opposite orientation) (Figure 1.)
N ccggaattccagtaaaaggcacagagc Forward, EcoRI site (underlined), located 2,138 nucleotides down-stream of glycosyl hidrolase family 45-2 start codon (Figure 1.)
O tcatctattttctcctttgaaagtaatcactatattcc Reverse, stop codon of glycosyl hydrolase family 45-2 (Figure 1.)
P tcaaaggagaaaatagatgaatatcttaaaaaataaaaagc Forward, located 40 nucleotides upstream of down gene start codon (Figure 1.)
Q ataagaatgcggccgcttagcgattgatcgagcg Reverse, NotI site (underlined), stop codon of down (Figure 1.)
R ataagaatgcggccgccagtaaaaggcacagagc Forward, NotI site (underlined), located 2,138 nucleotides down-stream of glycosyl hydrolase family 45-2 start codon (Figure 1.)
S tcatctattttctcctttgaaagtaatcactatattcc Reverse, stop codon of glycosyl hydrolase family 45-2 (Figure 1.)
T tcaaaggagaaaatagatgacaaaattaaataaaaaatgg Forward, 1,973 nucleotides upstream of stop codon of GMP synthase (Figure 1.)
U cggaattcgaatttgtatatgtcttcg Reverse, EcoRI site (underlined), 994 nucleotides upstream of start codon of GMP synthase (opposite direction) (Figure 1.)
V aaggaaaaaagcggccgccagaatatgataatcgtcatgg Forward, NotI site (underlined), 902 nucleotides downstream of hyl Efm start codon (Figure 1.)
W tttgttctcctttttcttgctttttattttttaag Reverse, stop codon of of hyl Efm (Figure 1.)
X gcaagaaaaaggagaacaaacaaaattaaataaaaaatgg Forward, 1,973 nucleotides upstream of stop codon of GMP synthase (opposite direction) (Figure 1.)
Y ccggaattcgaatcaggaactgaaactgccc Reverse, EcoRI site (underlined), 1,094 nucleotides upstream of stop codon of GMP synthase (opposite direction) (Figure 1.)
A1 cgcgtcgtattaaaaatcat Forward, 143 nucleotides upstream of stop codon of GH20 (Figure 3.)
A2 gatcgataaactggctcgt Reverse, 139 nucleotides upstream of start codon of GH42 (Figure 3.)
B1 acgcgtcgacagcagctggatatgctga Forward, SalI site (underlined), 2,316 nucleotides downstream of start codon of GH42 (Figure 3.)
B2 ggaagatctccggtttccagacttctt Reverse, BglII site (underlined), 159 nucleotides downstream of start codon of hyl Efm (Figure 3.)
C1 gttagaagaagtctggaaaccg Forward, 138 nucleotides downstream of start codon of hyl Efm (Figure 3.)
C2 tgctaagatattcctctactcg Reverse, 798 nucleotides upstream of stop codon of hyl Efm (Figure 3.)
D1 acatgcatgcagaattggagccttggtt Forward, SphI site (underlined), 169 nucleotides upstream of stop codon of hyl Efm (Figure 3.)
D2 cggaattctgcttccgcataagaaa Reverse, EcoRI site (underlined), 319 nucleotides upstream of stop codon of down gene (Figure 3.)
E1 gcaaggcttcttagaga Forward, ddl E. faecium [32, 33]
E2 catcgtgtaagctaacttc Reverse, ddl E. faecium [32, 33]