Primer | Sequence (5'-3') | Relevant Characteristics |
---|---|---|
A | gaagatctgagataggttatgcaagat | Forward, BglII site (underlined), used amplification of aph-2"-ID |
B | ccaatgcatgattccggattctaaaaaagg | Reverse, NsiI site (underlined), used amplification of aph-2"-ID |
C | cgggatccgtttaaaaccagctggaaaag | Forward, BamHI site (underlined), located 1,251 nucleotides upstream of the start codon of the gene encoding a putative glycosyl hydrolase family 20 (Figure 1.) |
D | ccgctcgagcaattcaacattgcaaagac | Reverse, XhoI site (underlined), located 294 nucleotides upstream of the start codon of the gene encoding a putative glycosyl hydrolase family 20 (Figure 1.) |
E | cgagggcccgtgaagtattgccagatgt | Forward, ApaI site (underlined); located 592 nucleotides downstream of the down gene (hypothetical, Figure 1.) |
F | ccggaattcaaaagcagaattggaaatca | Reverse, EcoRI site, 1,571 nucleotides downstream of the down gene (hypothetical, Figure 1.) |
G | gcgagctcgattactttcaaaggaga | Forward, SacI site (underlined), ribosomal binding site of hyl Efm (italics) (Figure 1.) |
H | tcccccggg ctaacttttgataatttgctc | Reverse, SmaI site, (underlined) and stop codon of hyl Efm (Figure 1.) |
I | tcccccggg ttagcgattgatcgagc | Reverse, SmaI site (underlined), stop codon of down (Figure 1.) |
J | cgggatcccaatcaagaagtagcggatt | Forward, BamH site (underlined) 438 nucleotides upstream of the stop codon of carbohydrate ABC transporter gene (Figure 1.) |
K | gcggccgctcgagggcccttagtgcgattgtatctgac | Reverse, stop codon of the gene that encodes to transmembrane protein (Figure 1.) |
L | gggcccctcgaggcggccgcaaaattaaataaaaaatgg | Forward, ApaI, XhoI, NotI site, stop codon down (Figure 1.) |
M | catgcatgaatcaggaactgaaactgc | Reverse, NsiI site, 1,091 nucleotides upstream of stop codon of GMP synthase (opposite orientation) (Figure 1.) |
N | ccggaattccagtaaaaggcacagagc | Forward, EcoRI site (underlined), located 2,138 nucleotides down-stream of glycosyl hidrolase family 45-2 start codon (Figure 1.) |
O | tcatctattttctcctttgaaagtaatcactatattcc | Reverse, stop codon of glycosyl hydrolase family 45-2 (Figure 1.) |
P | tcaaaggagaaaatagatgaatatcttaaaaaataaaaagc | Forward, located 40 nucleotides upstream of down gene start codon (Figure 1.) |
Q | ataagaatgcggccgcttagcgattgatcgagcg | Reverse, NotI site (underlined), stop codon of down (Figure 1.) |
R | ataagaatgcggccgccagtaaaaggcacagagc | Forward, NotI site (underlined), located 2,138 nucleotides down-stream of glycosyl hydrolase family 45-2 start codon (Figure 1.) |
S | tcatctattttctcctttgaaagtaatcactatattcc | Reverse, stop codon of glycosyl hydrolase family 45-2 (Figure 1.) |
T | tcaaaggagaaaatagatgacaaaattaaataaaaaatgg | Forward, 1,973 nucleotides upstream of stop codon of GMP synthase (Figure 1.) |
U | cggaattcgaatttgtatatgtcttcg | Reverse, EcoRI site (underlined), 994 nucleotides upstream of start codon of GMP synthase (opposite direction) (Figure 1.) |
V | aaggaaaaaagcggccgccagaatatgataatcgtcatgg | Forward, NotI site (underlined), 902 nucleotides downstream of hyl Efm start codon (Figure 1.) |
W | tttgttctcctttttcttgctttttattttttaag | Reverse, stop codon of of hyl Efm (Figure 1.) |
X | gcaagaaaaaggagaacaaacaaaattaaataaaaaatgg | Forward, 1,973 nucleotides upstream of stop codon of GMP synthase (opposite direction) (Figure 1.) |
Y | ccggaattcgaatcaggaactgaaactgccc | Reverse, EcoRI site (underlined), 1,094 nucleotides upstream of stop codon of GMP synthase (opposite direction) (Figure 1.) |
A1 | cgcgtcgtattaaaaatcat | Forward, 143 nucleotides upstream of stop codon of GH20 (Figure 3.) |
A2 | gatcgataaactggctcgt | Reverse, 139 nucleotides upstream of start codon of GH42 (Figure 3.) |
B1 | acgcgtcgacagcagctggatatgctga | Forward, SalI site (underlined), 2,316 nucleotides downstream of start codon of GH42 (Figure 3.) |
B2 | ggaagatctccggtttccagacttctt | Reverse, BglII site (underlined), 159 nucleotides downstream of start codon of hyl Efm (Figure 3.) |
C1 | gttagaagaagtctggaaaccg | Forward, 138 nucleotides downstream of start codon of hyl Efm (Figure 3.) |
C2 | tgctaagatattcctctactcg | Reverse, 798 nucleotides upstream of stop codon of hyl Efm (Figure 3.) |
D1 | acatgcatgcagaattggagccttggtt | Forward, SphI site (underlined), 169 nucleotides upstream of stop codon of hyl Efm (Figure 3.) |
D2 | cggaattctgcttccgcataagaaa | Reverse, EcoRI site (underlined), 319 nucleotides upstream of stop codon of down gene (Figure 3.) |
E1 | gcaaggcttcttagaga | |
E2 | catcgtgtaagctaacttc |