Skip to main content

Table 2 Oligonucleotides used in this study

From: Genotypic and phenotypic diversity of Ralstonia pickettii and Ralstonia insidiosa isolates from clinical and environmental sources including High-purity Water. Diversity in Ralstonia pickettii

Primer Oligonucleotide Sequence 5'-3' Targeta Product size Reference
Rp-F1 ATGATCTAGCTTGCTAGATTGAT 16S rRNA gene 210 bp [32]
Rp-R1 ACTGATCGTCGCCTTGGTG 16S rRNA gene   [32]
R38R1 CACACCTAATATTAGTAAGTGCG 16S rRNA gene 403 bp [33]
16SF TTGTACACACCGCCCGTCA 16S-23S Spacer Region 860 bp [34]
23SR GGTACCTTAGATGTTTCAGTTC 16S-23S Spacer Region   [34]
Ral_fliCF CCTCAGCCTCAATACCAACATC fliC gene 725 bp [35]
Ral_fliCR CATGTTCGACGTTTCMGAWGC fliC gene   [35]
M13 TTATGTAAAACGACGGCCAGT RAPD Primer N\A [36]
P3 AGACGTCCAC RAPD Primer N\A [37]
P15 AATGGCGCAG RAPD Primer N\A [37]
OPA03U AGTCAGCCAC RAPD Primer N\A [38]
BOX-A1R CTACGGCAAGGCGACGCTGACG BOX Primer N\A [39]