Skip to main content

Table 1 Primers used in this work

From: "Glucose and ethanol-dependent transcriptional regulation of the astaxanthin biosynthesis pathway in Xanthophyllomyces dendrorhous"

Primer Gene Direction Sequence (5' to 3') Location
mactF-RT act F CCGCCCTCGTGATTGATAAC Spanning exons 2 & 3
mactR-RT act R TCACCAACGTAGGAGTCCTT Spanning exons 4 & 5
mmcrtYBF2-RT crtYB(mm) F TCGCATATTACCAGATCCATCTGA Spanning exons 1 & 2
mmcrtYBR2-RT crtYB(mm) R GGATATGTCCATGCGCCATT Exon 2
amcrtYBF-RT crtYB(am) F GTGTGCATATGTGTTGCAACCA Spanning exon 1 & intron 2
amcrtYBR-RT crtYB(am) R AGAAGGTGCCTAGTTGCCAAGA Exon 3
mmcrtIF-RT crtI(mm) F CATCGTGGGATGTGGTATCG Spanning exons 1 & 2
mmcrtIR-RT crtI(mm) R GGCCCCTGATCGAATCGATAA Spanning exons 3, 4, 5
amcrtIF-RT crtI(am) F CGTGGTTTAATCCGTATCAGC Spanning exon 1 & intron 1
amcrtIR2-RT crtI(am) R TCTCGAACACCGTGACCT Exon 2
mcrtSF-RT crtS F ATGGCTCTTGCAGGGTTTGA Spanning exons 6 & 7
mcrtSR-RT crtS R TGCTCCATAAGCTCGATCCCAA Spanning exons 8 & 9
grg2real FW1 grg2 F CATCAAGACCTCTGTCACCAAC Spanning exons 1 & 2
grg2real RV1 grg2 R TTGGCGTCAGACGAGGACT Exon 3
pdcreal FW1 PDC F TCAACACTGAGCTGCCCACT Spanning exons 5 & 6
pdcreal RV1 PDC R ATTCCGAATCGGGAAGCACA Exon 6
  1. F: Forward, R: Reverse; (mm): mature transcript, (am): alternatively spliced transcript.