Skip to main content

Table 2 Oligonucleotide primers used for the construction of chimeras and mutants of PCV2

From: Identification of one critical amino acid that determines a conformational neutralizing epitope in the capsid protein of porcine circovirus type 2

Chimera/mutant Primer Sequence
rCL-YJ-1 A-F 5'-AGATTTAATATTAACGACTTTGTTC-3'
  A-R 5'-GTTGAAGATGCCATTTTTCCT-3'
  B-F 5'-AGGAAAAATGGCATCTTCAACGCCCGCCTCTCCCGCACCTTCGGATATACTATCAAGCGAG
CCACAGTCAAAACGCCCTCCTGGGCGGTGGACATGATGAGATTTAATATTAACGACTTT-3'
  B-R 5'-AAAGTCGTTAATATTAAATCTCATCATGTCCACCGCCCAGGAGGGCGTTTTGACTGTGGCTC
GCTTGATAGTATATCCGAAGGTGCGGGAGAGGCGGGCGTTGAAGATGCCATTTTTCCT-3'
rCL-YJ-2 C-F 5'-TACTACAGAATAAGGAAGGTTAAGG-3'
  C-R 5'-AAAGTCGTTAATATTAAATCTAATC-3'
  D-F 5'-ATTAGATTTAATATTAACGACTTTCTTCCCCCAGGAGGGGGCTCAAACCCCCGCTCTGTGCC
CTTTGAATACTACAGAATAAGGAAGGTTAAG-3'
  D-R 5'-CTTAACCTTCCTTATTCTGTAGTATTCAAAGGGCACAGAGCGGGGGTTTGAGCCCCCTCCT
GGGGGAAGAAAGTCGTTAATATTAAATCTAAT- 3'
rCL-YJ-3 E-F 5'-TCCTACCACTCCCGGTACTTTA-3'
  E-R 5'-GGAGCAGGGCCAGAATTCAA-3'
  F-F 5'-TAAGGTTGAATTCTGGCCCTGCTCCCCGATCACCCAGGGTGACAGGGGAGTGGGCTCCAG
TGCTGCTATTCTAGATGATAACTTTGTAACAAAGGCCACAGCCCTCACCTATGACCCCTATGTA
AACTACTCCTCCCGCCATACCATAACCCAGCCCTTCTCCTACCACTCCCGCTACTTTACCC-3'
  F-R 5'-GGGTAAAGTACCGGGAGTGGTAGGAGAAGGGCTGGGTTATGGTATGGCGGGAGGAGTAGT
TTACATAGGGGTCATAGGTGAGGGCTGTGGCCTTTGTTACAAAGTTATCATCTAGAATAGCAGC
ACTGGAGC CCACTCCCCTGTCACCCTGGGTGATCGGGGAGCAGGGCCAGAATTCAACCTTA-3'
rCL-YJ-4 G-F 5'-AATATCCGGGTAACTATGTATGT-3'
  G-R 5'-GGTTTGTAGTCTCAGCCAAAG-3'
  H-F 5'-CTTTGGCTGAGACTACAAACCGCTGGAAATGTAGACCACGTAGGCCTCGGCACTGCGTTC
GAAAACAGTATATACGACCAGGAATACAATATCCGGGTAACTATGTAT-3'
  H-R 5'-ATACATAGTTACCCGGATATTGTATTCCTGGTCGTATATACTGTTTTCGAACGCAGTGCCGA
GGCCTACGTGGTCTACATTTCCAGCGGTTTGTAGTCTCAGCCAAAG-3'
rCL-YJ-5 I-F 5'-GACCCCCCACTTAACCTTAATGAATAATAAAAAC-3'
  I-R 5'-GTTTTTATTATTCATTAAGGTTAAGTGGGGGGTC-3'
rCL-YJ-1-51 J-F 5'-CACCCGCCTCTCCCGCACCTTCGGATA-3'
  J-R 5'-TATCCGAAGGTGCGGGAGAGGCGGGTG-3'
rCL-YJ-1-57 K-F 5'-ACCTTCGGATATACTATCAAGGCTACCAC-3'
  K-R 5'-GTGGTAGCCTTGATAGTATATCCGAAGGT-3'
rCL-YJ-1-59 L-F 5'-GGATATACTGTCAAGCGAACCACAGTCAGAAC-3'
  L-R 5'-GTTCTGACTGTGGTTCGCTTGACAGTATATCC-3'
rCL-YJ-1-63 M-F 5'-GCTACCACAGTCAAAACGCCCTCCTGG-3'
  M-R 5'-CCAGGAGGGCGTTTTGACTGTGGTAGC-3'
rLG-YJ-1-59 N-F 5'-GGATATACTGTCAAGCGAACCACAGTCAGAAC-3'
  N-R 5'-GTTCTGACTGTGGTTCGCTTGACAGTATATCC-3'
rJF2-YJ-1-59 O-F 5'-GGATATACTGTCAAGCGAACCACAGTCAGAAC-3'
  O-R 5'-GTTCTGACTGTGGTTCGCTTGACAGTATATCC-3'
rYJ-CL-1-59 P-F 5'-CGGATATACTATCAAGGCTGCCACAGTCAAAAC-3'
  P-R 5'-GTTTTGACTGTGGCAGCCTTGATAGTATATCCG-3'
complete genome of PCV2 Q-F 5'-GTCGACGGAGGAAGGGGGCCAGTT-3'
  Q-R 5'-GTCGACTGTTCTGTAGCATTCTTCCA-3'